Skip to main content Skip to footer
HomeHome
 
  • Homepage
  • Searching for patents

    Patent knowledge

    Access our patent databases and search tools.

    Go to overview 

    • Overview
    • Technical information
      • Overview
      • Espacenet - patent search
      • European Publication Server
      • EP full-text search
    • Legal information
      • Overview
      • European Patent Register
      • European Patent Bulletin
      • European Case Law Identifier sitemap
      • Third-party observations
    • Business information
      • Overview
      • PATSTAT
      • IPscore
      • Technology insight reports
    • Data
      • Overview
      • Technology Intelligence Platform
      • Linked open EP data
      • Bulk data sets
      • Web services
      • Coverage, codes and statistics
    • Technology platforms
      • Overview
      • Plastics in transition
      • Water innovation
      • Space innovation
      • Technologies combatting cancer
      • Firefighting technologies
      • Clean energy technologies
      • Fighting coronavirus
    • Helpful resources
      • Overview
      • First time here?
      • Asian patent information
      • Patent information centres
      • Patent Translate
      • Patent Knowledge News
      • Business and statistics
      • Unitary Patent information in patent knowledge
    Image
    Plastics in Transition

    Technology insight report on plastic waste management

  • Applying for a patent

    Applying for a patent

    Practical information on filing and grant procedures.

    Go to overview 

    • Overview
    • European route
      • Overview
      • European Patent Guide
      • Oppositions
      • Oral proceedings
      • Appeals
      • Unitary Patent & Unified Patent Court
      • National validation
      • Request for extension/validation
    • International route (PCT)
      • Overview
      • Euro-PCT Guide – PCT procedure at the EPO
      • EPO decisions and notices
      • PCT provisions and resources
      • Extension/validation request
      • Reinforced partnership programme
      • Accelerating your PCT application
      • Patent Prosecution Highway (PPH)
      • Training and events
    • National route
    • Find a professional representative
    • MyEPO services
      • Overview
      • Understand our services
      • Get access
      • File with us
      • Interact with us on your files
      • Online Filing & fee payment outages
    • Forms
      • Overview
      • Request for examination
    • Fees
      • Overview
      • European fees (EPC)
      • International fees (PCT)
      • Unitary Patent fees (UP)
      • Fee payment and refunds
      • Warning

    UP

    Find out how the Unitary Patent can enhance your IP strategy

  • Law & practice

    Law & practice

    European patent law, the Official Journal and other legal texts.

    Go to overview 

    • Overview
    • Legal texts
      • Overview
      • European Patent Convention
      • Official Journal
      • Guidelines
      • Extension / validation system
      • London Agreement
      • National law relating to the EPC
      • Unitary patent system
      • National measures relating to the Unitary Patent
    • Court practices
      • Overview
      • European Patent Judges' Symposium
    • User consultations
      • Overview
      • Ongoing consultations
      • Completed consultations
    • Substantive patent law harmonisation
      • Overview
      • The Tegernsee process
      • Group B+
    • Convergence of practice
    • Options for professional representatives
    Image
    Law and practice scales 720x237

    Keep up with key aspects of selected BoA decisions with our monthly "Abstracts of decisions”

  • News & events

    News & events

    Our latest news, podcasts and events, including the European Inventor Award.

    Go to overview 

     

    • Overview
    • News
    • Events
    • European Inventor Award
      • Overview
      • The meaning of tomorrow
      • About the award
      • Categories and prizes
      • Meet the finalists
      • Nominations
      • European Inventor Network
      • The 2024 event
    • Young Inventors Prize
      • Overview
      • About the prize
      • Nominations
      • The jury
      • The world, reimagined
    • Press centre
      • Overview
      • Patent Index and statistics
      • Search in press centre
      • Background information
      • Copyright
      • Press contacts
      • Call back form
      • Email alert service
    • Innovation and patenting in focus
      • Overview
      • Water-related technologies
      • CodeFest
      • Green tech in focus
      • Research institutes
      • Women inventors
      • Lifestyle
      • Space and satellites
      • The future of medicine
      • Materials science
      • Mobile communications
      • Biotechnology
      • Patent classification
      • Digital technologies
      • The future of manufacturing
      • Books by EPO experts
    • "Talk innovation" podcast

    Podcast

    From ideas to inventions: tune into our podcast for the latest in tech and IP

  • Learning

    Learning

    The European Patent Academy – the point of access to your learning

    Go to overview 

    • Overview
    • Learning activities and paths
      • Overview
      • Learning activities
      • Learning paths
    • EQE and EPAC
      • Overview
      • EQE - European qualifying examination
      • EPAC - European patent administration certification
      • CSP – Candidate Support Programme
    • Learning resources by area of interest
      • Overview
      • Patent granting
      • Technology transfer and dissemination
      • Patent enforcement and litigation
    • Learning resources by profile
      • Overview
      • Business and IP managers
      • EQE and EPAC Candidates
      • Judges, lawyers and prosecutors
      • National offices and IP authorities
      • Patent attorneys and paralegals
      • Universities, research centres and technology transfer centres (TTOs)
    Image
    Patent Academy catalogue

    Have a look at the extensive range of learning opportunities in the European Patent Academy training catalogue

  • About us

    About us

    Find out more about our work, values, history and vision

    Go to overview 

    • Overview
    • The EPO at a glance
    • 50 years of the EPC
      • Overview
      • Official celebrations
      • Member states’ video statements
      • 50 Leading Tech Voices
      • Athens Marathon
      • Kids’ collaborative art competition
    • Legal foundations and member states
      • Overview
      • Legal foundations
      • Member states of the European Patent Organisation
      • Extension states
      • Validation states
    • Administrative Council and subsidiary bodies
      • Overview
      • Communiqués
      • Calendar
      • Documents and publications
      • Administrative Council
    • Principles & strategy
      • Overview
      • Our mission, vision, values and corporate policy
      • Strategic Plan 2028
      • Towards a New Normal
    • Leadership & management
      • Overview
      • President António Campinos
      • Management Advisory Committee
    • Sustainability at the EPO
      • Overview
      • Environmental
      • Social
      • Governance and Financial sustainability
    • Services & activities
      • Overview
      • Our services & structure
      • Quality
      • Consulting our users
      • European and international co-operation
      • European Patent Academy
      • Chief Economist
      • Ombuds Office
      • Reporting wrongdoing
    • Observatory on Patents and Technology
      • Overview
      • Technologies
      • Innovation actors
      • Policy and funding
      • Tools
      • About the Observatory
    • Procurement
      • Overview
      • Procurement forecast
      • Doing business with the EPO
      • Procurement procedures
      • Sustainable Procurement Policy
      • About eTendering and electronic signatures
      • Procurement portal
      • Invoicing
      • General conditions
      • Archived tenders
    • Transparency portal
      • Overview
      • General
      • Human
      • Environmental
      • Organisational
      • Social and relational
      • Economic
      • Governance
    • Statistics and trends
      • Overview
      • Statistics & Trends Centre
      • Patent Index 2024
      • EPO Data Hub
      • Clarification on data sources
    • History
      • Overview
      • 1970s
      • 1980s
      • 1990s
      • 2000s
      • 2010s
      • 2020s
    • Art collection
      • Overview
      • The collection
      • Let's talk about art
      • Artists
      • Media library
      • What's on
      • Publications
      • Contact
      • Culture Space A&T 5-10
      • "Long Night"
    Image
    Patent Index 2024 keyvisual showing brightly lit up data chip, tinted in purple, bright blue

    Track the latest tech trends with our Patent Index

 
en de fr
  • Language selection
  • English
  • Deutsch
  • Français
Main navigation
  • Homepage
    • Go back
    • New to patents
  • New to patents
    • Go back
    • Your business and patents
    • Why do we have patents?
    • What's your big idea?
    • Are you ready?
    • What to expect
    • How to apply for a patent
    • Is it patentable?
    • Are you first?
    • Patent quiz
    • Unitary patent video
  • Searching for patents
    • Go back
    • Overview
    • Technical information
      • Go back
      • Overview
      • Espacenet - patent search
        • Go back
        • Overview
        • National patent office databases
        • Global Patent Index (GPI)
        • Release notes
      • European Publication Server
        • Go back
        • Overview
        • Release notes
        • Cross-reference index for Euro-PCT applications
        • EP authority file
        • Help
      • EP full-text search
    • Legal information
      • Go back
      • Overview
      • European Patent Register
        • Go back
        • Overview
        • Release notes archive
        • Register documentation
          • Go back
          • Overview
          • Deep link data coverage
          • Federated Register
          • Register events
      • European Patent Bulletin
        • Go back
        • Overview
        • Download Bulletin
        • EP Bulletin search
        • Help
      • European Case Law Identifier sitemap
      • Third-party observations
    • Business information
      • Go back
      • Overview
      • PATSTAT
      • IPscore
        • Go back
        • Release notes
      • Technology insight reports
    • Data
      • Go back
      • Overview
      • Technology Intelligence Platform
      • Linked open EP data
      • Bulk data sets
        • Go back
        • Overview
        • Manuals
        • Sequence listings
        • National full-text data
        • European Patent Register data
        • EPO worldwide bibliographic data (DOCDB)
        • EP full-text data
        • EPO worldwide legal event data (INPADOC)
        • EP bibliographic data (EBD)
        • Boards of Appeal decisions
      • Web services
        • Go back
        • Overview
        • Open Patent Services (OPS)
        • European Publication Server web service
      • Coverage, codes and statistics
        • Go back
        • Weekly updates
        • Updated regularly
    • Technology platforms
      • Go back
      • Overview
      • Plastics in transition
        • Go back
        • Overview
        • Plastics waste recovery
        • Plastics waste recycling
        • Alternative plastics
      • Innovation in water technologies
        • Go back
        • Overview
        • Clean water
        • Protection from water
      • Space innovation
        • Go back
        • Overview
        • Cosmonautics
        • Space observation
      • Technologies combatting cancer
        • Go back
        • Overview
        • Prevention and early detection
        • Diagnostics
        • Therapies
        • Wellbeing and aftercare
      • Firefighting technologies
        • Go back
        • Overview
        • Detection and prevention of fires
        • Fire extinguishing
        • Protective equipment
        • Post-fire restoration
      • Clean energy technologies
        • Go back
        • Overview
        • Renewable energy
        • Carbon-intensive industries
        • Energy storage and other enabling technologies
      • Fighting coronavirus
        • Go back
        • Overview
        • Vaccines and therapeutics
          • Go back
          • Overview
          • Vaccines
          • Overview of candidate therapies for COVID-19
          • Candidate antiviral and symptomatic therapeutics
          • Nucleic acids and antibodies to fight coronavirus
        • Diagnostics and analytics
          • Go back
          • Overview
          • Protein and nucleic acid assays
          • Analytical protocols
        • Informatics
          • Go back
          • Overview
          • Bioinformatics
          • Healthcare informatics
        • Technologies for the new normal
          • Go back
          • Overview
          • Devices, materials and equipment
          • Procedures, actions and activities
          • Digital technologies
        • Inventors against coronavirus
    • Helpful resources
      • Go back
      • Overview
      • First time here?
        • Go back
        • Overview
        • Basic definitions
        • Patent classification
          • Go back
          • Overview
          • Cooperative Patent Classification (CPC)
        • Patent families
          • Go back
          • Overview
          • DOCDB simple patent family
          • INPADOC extended patent family
        • Legal event data
          • Go back
          • Overview
          • INPADOC classification scheme
      • Asian patent information
        • Go back
        • Overview
        • China (CN)
          • Go back
          • Overview
          • Facts and figures
          • Grant procedure
          • Numbering system
          • Useful terms
          • Searching in databases
        • Chinese Taipei (TW)
          • Go back
          • Overview
          • Grant procedure
          • Numbering system
          • Useful terms
          • Searching in databases
        • India (IN)
          • Go back
          • Overview
          • Facts and figures
          • Grant procedure
          • Numbering system
        • Japan (JP)
          • Go back
          • Overview
          • Facts and figures
          • Grant procedure
          • Numbering system
          • Useful terms
          • Searching in databases
        • Korea (KR)
          • Go back
          • Overview
          • Facts and figures
          • Grant procedure
          • Numbering system
          • Useful terms
          • Searching in databases
        • Russian Federation (RU)
          • Go back
          • Overview
          • Facts and figures
          • Numbering system
          • Searching in databases
        • Useful links
      • Patent information centres (PATLIB)
      • Patent Translate
      • Patent Knowledge News
      • Business and statistics
      • Unitary Patent information in patent knowledge
  • Applying for a patent
    • Go back
    • Overview
    • European route
      • Go back
      • Overview
      • European Patent Guide
      • Oppositions
      • Oral proceedings
        • Go back
        • Oral proceedings calendar
          • Go back
          • Calendar
          • Public access to appeal proceedings
          • Public access to opposition proceedings
          • Technical guidelines
      • Appeals
      • Unitary Patent & Unified Patent Court
        • Go back
        • Overview
        • Unitary Patent
          • Go back
          • Overview
          • Legal framework
          • Main features
          • Applying for a Unitary Patent
          • Cost of a Unitary Patent
          • Translation and compensation
          • Start date
          • Introductory brochures
        • Unified Patent Court
      • National validation
      • Extension/validation request
    • International route
      • Go back
      • Overview
      • Euro-PCT Guide
      • Entry into the European phase
      • Decisions and notices
      • PCT provisions and resources
      • Extension/validation request
      • Reinforced partnership programme
      • Accelerating your PCT application
      • Patent Prosecution Highway (PPH)
        • Go back
        • Patent Prosecution Highway (PPH) programme outline
      • Training and events
    • National route
    • MyEPO services
      • Go back
      • Overview
      • Understand our services
        • Go back
        • Overview
        • Exchange data with us using an API
          • Go back
          • Release notes
      • Get access
        • Go back
        • Overview
        • Release notes
      • File with us
        • Go back
        • Overview
        • What if our online filing services are down?
        • Release notes
      • Interact with us on your files
        • Go back
        • Release notes
      • Online Filing & fee payment outages
    • Fees
      • Go back
      • Overview
      • European fees (EPC)
        • Go back
        • Overview
        • Decisions and notices
      • International fees (PCT)
        • Go back
        • Reduction in fees
        • Fees for international applications
        • Decisions and notices
        • Overview
      • Unitary Patent fees (UP)
        • Go back
        • Overview
        • Decisions and notices
      • Fee payment and refunds
        • Go back
        • Overview
        • Payment methods
        • Getting started
        • FAQs and other documentation
        • Technical information for batch payments
        • Decisions and notices
        • Release notes
      • Warning
    • Forms
      • Go back
      • Overview
      • Request for examination
    • Find a professional representative
  • Law & practice
    • Go back
    • Overview
    • Legal texts
      • Go back
      • Overview
      • European Patent Convention
        • Go back
        • Overview
        • Archive
          • Go back
          • Overview
          • Documentation on the EPC revision 2000
            • Go back
            • Overview
            • Diplomatic Conference for the revision of the EPC
            • Travaux préparatoires
            • New text
            • Transitional provisions
            • Implementing regulations to the EPC 2000
            • Rules relating to Fees
            • Ratifications and accessions
          • Travaux Préparatoires EPC 1973
      • Official Journal
      • Guidelines
        • Go back
        • Overview
        • EPC Guidelines
        • PCT-EPO Guidelines
        • Unitary Patent Guidelines
        • Guidelines revision cycle
        • Consultation results
        • Summary of user responses
        • Archive
      • Extension / validation system
      • London Agreement
      • National law relating to the EPC
        • Go back
        • Overview
        • Archive
      • Unitary Patent system
        • Go back
        • Travaux préparatoires to UP and UPC
      • National measures relating to the Unitary Patent 
    • Court practices
      • Go back
      • Overview
      • European Patent Judges' Symposium
    • User consultations
      • Go back
      • Overview
      • Ongoing consultations
      • Completed consultations
    • Substantive patent law harmonisation
      • Go back
      • Overview
      • The Tegernsee process
      • Group B+
    • Convergence of practice
    • Options for professional representatives
  • News & events
    • Go back
    • Overview
    • News
    • Events
    • European Inventor Award
      • Go back
      • Overview
      • The meaning of tomorrow
      • About the award
      • Categories and prizes
      • Meet the inventors
      • Nominations
      • European Inventor Network
        • Go back
        • 2024 activities
        • 2025 activities
        • Rules and criteria
        • FAQ
      • The 2024 event
    • Young Inventors Prize
      • Go back
      • Overview
      • About the prize
      • Nominations
      • The jury
      • The world, reimagined
      • The 2025 event
    • Press centre
      • Go back
      • Overview
      • Patent Index and statistics
      • Search in press centre
      • Background information
        • Go back
        • Overview
        • European Patent Office
        • Q&A on patents related to coronavirus
        • Q&A on plant patents
      • Copyright
      • Press contacts
      • Call back form
      • Email alert service
    • In focus
      • Go back
      • Overview
      • Water-related technologies
      • CodeFest
        • Go back
        • CodeFest Spring 2025 on classifying patent data for sustainable development
        • Overview
        • CodeFest 2024 on generative AI
        • CodeFest 2023 on Green Plastics
      • Green tech in focus
        • Go back
        • Overview
        • About green tech
        • Renewable energies
        • Energy transition technologies
        • Building a greener future
      • Research institutes
      • Women inventors
      • Lifestyle
      • Space and satellites
        • Go back
        • Overview
        • Patents and space technologies
      • Healthcare
        • Go back
        • Overview
        • Medical technologies and cancer
        • Personalised medicine
      • Materials science
        • Go back
        • Overview
        • Nanotechnology
      • Mobile communications
      • Biotechnology
        • Go back
        • Overview
        • Red, white or green
        • The role of the EPO
        • What is patentable?
        • Biotech inventors
      • Classification
        • Go back
        • Overview
        • Nanotechnology
        • Climate change mitigation technologies
          • Go back
          • Overview
          • External partners
          • Updates on Y02 and Y04S
      • Digital technologies
        • Go back
        • Overview
        • About ICT
        • Hardware and software
        • Artificial intelligence
        • Fourth Industrial Revolution
      • Additive manufacturing
        • Go back
        • Overview
        • About AM
        • AM innovation
      • Books by EPO experts
    • Podcast
  • Learning
    • Go back
    • Overview
    • Learning activities and paths
      • Go back
      • Overview
      • Learning activities: types and formats
      • Learning paths
    • EQE and EPAC
      • Go back
      • Overview
      • EQE - European Qualifying Examination
        • Go back
        • Overview
        • Compendium
          • Go back
          • Overview
          • Paper F
          • Paper A
          • Paper B
          • Paper C
          • Paper D
          • Pre-examination
        • Candidates successful in the European qualifying examination
        • Archive
      • EPAC - European patent administration certification
      • CSP – Candidate Support Programme
    • Learning resources by area of interest
      • Go back
      • Overview
      • Patent granting
      • Technology transfer and dissemination
      • Patent enforcement and litigation
    • Learning resources by profile
      • Go back
      • Overview
      • Business and IP managers
        • Go back
        • Overview
        • Innovation case studies
          • Go back
          • Overview
          • SME case studies
          • Technology transfer case studies
          • High-growth technology case studies
        • Inventor's handbook
          • Go back
          • Overview
          • Introduction
          • Disclosure and confidentiality
          • Novelty and prior art
          • Competition and market potential
          • Assessing the risk ahead
          • Proving the invention
          • Protecting your idea
          • Building a team and seeking funding
          • Business planning
          • Finding and approaching companies
          • Dealing with companies
        • Best of search matters
          • Go back
          • Overview
          • Tools and databases
          • EPO procedures and initiatives
          • Search strategies
          • Challenges and specific topics
        • Support for high-growth technology businesses
          • Go back
          • Overview
          • Business decision-makers
          • IP professionals
          • Stakeholders of the Innovation Ecosystem
      • EQE and EPAC Candidates
        • Go back
        • Overview
        • Paper F brain-teasers
        • Daily D questions
        • European qualifying examination - Guide for preparation
        • EPAC
      • Judges, lawyers and prosecutors
        • Go back
        • Overview
        • Compulsory licensing in Europe
        • The jurisdiction of European courts in patent disputes
      • National offices and IP authorities
        • Go back
        • Overview
        • Learning material for examiners of national officers
        • Learning material for formalities officers and paralegals
      • Patent attorneys and paralegals
      • Universities, research centres and TTOs
        • Go back
        • Overview
        • Modular IP Education Framework (MIPEF)
        • Pan-European Seal Young Professionals Programme
          • Go back
          • Overview
          • For students
          • For universities
            • Go back
            • Overview
            • IP education resources
            • University memberships
          • Our young professionals
          • Professional development plan
        • Academic Research Programme
          • Go back
          • Overview
          • Completed research projects
          • Current research projects
        • IP Teaching Kit
          • Go back
          • Overview
          • Download modules
        • Intellectual property course design manual
        • PATLIB Knowledge Transfer to Africa
          • Go back
          • The PATLIB Knowledge Transfer to Africa initiative (KT2A)
          • KT2A core activities
          • Success story: Malawi University of Science and Technology and PATLIB Birmingham
  • About us
    • Go back
    • Overview
    • The EPO at a glance
    • 50 years of the EPC
      • Go back
      • Official celebrations
      • Overview
      • Member states’ video statements
        • Go back
        • Albania
        • Austria
        • Belgium
        • Bulgaria
        • Croatia
        • Cyprus
        • Czech Republic
        • Denmark
        • Estonia
        • Finland
        • France
        • Germany
        • Greece
        • Hungary
        • Iceland
        • Ireland
        • Italy
        • Latvia
        • Liechtenstein
        • Lithuania
        • Luxembourg
        • Malta
        • Monaco
        • Montenegro
        • Netherlands
        • North Macedonia
        • Norway
        • Poland
        • Portugal
        • Romania
        • San Marino
        • Serbia
        • Slovakia
        • Slovenia
        • Spain
        • Sweden
        • Switzerland
        • Türkiye
        • United Kingdom
      • 50 Leading Tech Voices
      • Athens Marathon
      • Kids’ collaborative art competition
    • Legal foundations and member states
      • Go back
      • Overview
      • Legal foundations
      • Member states
        • Go back
        • Overview
        • Member states by date of accession
      • Extension states
      • Validation states
    • Administrative Council and subsidiary bodies
      • Go back
      • Overview
      • Communiqués
        • Go back
        • 2024
        • Overview
        • 2023
        • 2022
        • 2021
        • 2020
        • 2019
        • 2018
        • 2017
        • 2016
        • 2015
        • 2014
        • 2013
      • Calendar
      • Documents and publications
        • Go back
        • Overview
        • Select Committee documents
      • Administrative Council
        • Go back
        • Overview
        • Composition
        • Representatives
        • Rules of Procedure
        • Board of Auditors
        • Secretariat
        • Council bodies
    • Principles & strategy
      • Go back
      • Overview
      • Mission, vision, values & corporate policy
      • Strategic Plan 2028
        • Go back
        • Driver 1: People
        • Driver 2: Technologies
        • Driver 3: High-quality, timely products and services
        • Driver 4: Partnerships
        • Driver 5: Financial sustainability
      • Towards a New Normal
      • Data protection & privacy notice
    • Leadership & management
      • Go back
      • Overview
      • About the President
      • Management Advisory Committee
    • Sustainability at the EPO
      • Go back
      • Overview
      • Environmental
        • Go back
        • Overview
        • Inspiring environmental inventions
      • Social
        • Go back
        • Overview
        • Inspiring social inventions
      • Governance and Financial sustainability
    • Procurement
      • Go back
      • Overview
      • Procurement forecast
      • Doing business with the EPO
      • Procurement procedures
      • Dynamic Purchasing System (DPS) publications
      • Sustainable Procurement Policy
      • About eTendering
      • Invoicing
      • Procurement portal
        • Go back
        • Overview
        • e-Signing contracts
      • General conditions
      • Archived tenders
    • Services & activities
      • Go back
      • Overview
      • Our services & structure
      • Quality
        • Go back
        • Overview
        • Foundations
          • Go back
          • Overview
          • European Patent Convention
          • Guidelines for examination
          • Our staff
        • Enabling quality
          • Go back
          • Overview
          • Prior art
          • Classification
          • Tools
          • Processes
        • Products & services
          • Go back
          • Overview
          • Search
          • Examination
          • Opposition
          • Continuous improvement
        • Quality through networking
          • Go back
          • Overview
          • User engagement
          • Co-operation
          • User satisfaction survey
          • Stakeholder Quality Assurance Panels
        • Patent Quality Charter
        • Quality Action Plan
        • Quality dashboard
        • Statistics
          • Go back
          • Overview
          • Search
          • Examination
          • Opposition
        • Integrated management at the EPO
      • Consulting our users
        • Go back
        • Overview
        • Standing Advisory Committee before the EPO (SACEPO)
          • Go back
          • Overview
          • Objectives
          • SACEPO and its working parties
          • Meetings
          • Single Access Portal – SACEPO Area
        • Surveys
          • Go back
          • Overview
          • Detailed methodology
          • Search services
          • Examination services, final actions and publication
          • Opposition services
          • Formalities services
          • Customer services
          • Filing services
          • Key Account Management (KAM)
          • Website
          • Archive
      • Our user service charter
      • European and international co-operation
        • Go back
        • Overview
        • Co-operation with member states
          • Go back
          • Overview
        • Bilateral co-operation with non-member states
          • Go back
          • Overview
          • Validation system
          • Reinforced Partnership programme
        • Multilateral international co-operation with IP offices and organisations
        • Co-operation with international organisations outside the IP system
      • European Patent Academy
        • Go back
        • Overview
        • Partners
      • Chief Economist
        • Go back
        • Overview
        • Economic studies
      • Ombuds Office
      • Reporting wrongdoing
    • Observatory on Patents and Technology
      • Go back
      • Overview
      • Technologies
        • Go back
        • Overview
        • Innovation against cancer
        • Assistive robotics
        • Space technologies
      • Innovation actors
        • Go back
        • Overview
        • Startups and SMEs
          • Go back
          • Overview
          • Publications
        • Research universities and public research organisations
      • Policy and funding
        • Go back
        • Overview
        • Financing innovation programme
          • Go back
          • Overview
          • Our studies on the financing of innovation
          • EPO initiatives for patent applicants
          • Financial support for innovators in Europe
        • Patents and standards
          • Go back
          • Overview
          • Publications
          • Patent standards explorer
      • Tools
        • Go back
        • Overview
        • Deep Tech Finder
      • About the Observatory
        • Go back
        • Overview
        • Work plan
    • Transparency portal
      • Go back
      • Overview
      • General
        • Go back
        • Overview
        • Annual Review 2023
          • Go back
          • Overview
          • Foreword
          • Executive summary
          • 50 years of the EPC
          • Strategic key performance indicators
          • Goal 1: Engaged and empowered
          • Goal 2: Digital transformation
          • Goal 3: Master quality
          • Goal 4: Partner for positive impact
          • Goal 5: Secure sustainability
        • Annual Review 2022
          • Go back
          • Overview
          • Foreword
          • Executive summary
          • Goal 1: Engaged and empowered
          • Goal 2: Digital transformation
          • Goal 3: Master quality
          • Goal 4: Partner for positive impact
          • Goal 5: Secure sustainability
      • Human
      • Environmental
      • Organisational
      • Social and relational
      • Economic
      • Governance
    • Statistics and trends
      • Go back
      • Overview
      • Statistics & Trends Centre
      • Patent Index 2024
        • Go back
        • Insight into computer technology and AI
        • Insight into clean energy technologies
        • Statistics and indicators
          • Go back
          • European patent applications
            • Go back
            • Key trend
            • Origin
            • Top 10 technical fields
              • Go back
              • Computer technology
              • Electrical machinery, apparatus, energy
              • Digital communication
              • Medical technology
              • Transport
              • Measurement
              • Biotechnology
              • Pharmaceuticals
              • Other special machines
              • Organic fine chemistry
            • All technical fields
          • Applicants
            • Go back
            • Top 50
            • Categories
            • Women inventors
          • Granted patents
            • Go back
            • Key trend
            • Origin
            • Designations
      • Data to download
      • EPO Data Hub
      • Clarification on data sources
    • History
      • Go back
      • Overview
      • 1970s
      • 1980s
      • 1990s
      • 2000s
      • 2010s
      • 2020s
    • Art collection
      • Go back
      • Overview
      • The collection
      • Let's talk about art
      • Artists
      • Media library
      • What's on
      • Publications
      • Contact
      • Culture Space A&T 5-10
        • Go back
        • Catalyst lab & Deep vision
          • Go back
          • Irene Sauter (DE)
          • AVPD (DK)
          • Jan Robert Leegte (NL)
          • Jānis Dzirnieks (LV) #1
          • Jānis Dzirnieks (LV) #2
          • Péter Szalay (HU)
          • Thomas Feuerstein (AT)
          • Tom Burr (US)
          • Wolfgang Tillmans (DE)
          • TerraPort
          • Unfinished Sculpture - Captives #1
          • Deep vision – immersive exhibition
          • Previous exhibitions
        • The European Patent Journey
        • Sustaining life. Art in the climate emergency
        • Next generation statements
        • Open storage
        • Cosmic bar
      • "Long Night"
  • Boards of Appeal
    • Go back
    • Overview
    • Decisions of the Boards of Appeal
      • Go back
      • Overview
      • Recent decisions
      • Selected decisions
    • Information from the Boards of Appeal
    • Procedure
    • Oral proceedings
    • About the Boards of Appeal
      • Go back
      • Overview
      • President of the Boards of Appeal
      • Enlarged Board of Appeal
        • Go back
        • Overview
        • Pending referrals (Art. 112 EPC)
        • Decisions sorted by number (Art. 112 EPC)
        • Pending petitions for review (Art. 112a EPC)
        • Decisions on petitions for review (Art. 112a EPC)
      • Technical Boards of Appeal
      • Legal Board of Appeal
      • Disciplinary Board of Appeal
      • Presidium
        • Go back
        • Overview
    • Code of Conduct
    • Business distribution scheme
      • Go back
      • Overview
      • Technical boards of appeal by IPC in 2025
      • Archive
    • Annual list of cases
    • Communications
    • Annual reports
      • Go back
      • Overview
    • Publications
      • Go back
      • Abstracts of decisions
    • Case Law of the Boards of Appeal
      • Go back
      • Overview
      • Archive
  • Service & support
    • Go back
    • Overview
    • Website updates
    • Availability of online services
      • Go back
      • Overview
    • FAQ
      • Go back
      • Overview
    • Publications
    • Ordering
      • Go back
      • Overview
      • Patent Knowledge Products and Services
      • Terms and conditions
        • Go back
        • Overview
        • Patent information products
        • Bulk data sets
        • Open Patent Services (OPS)
        • Fair use charter
    • Procedural communications
    • Useful links
      • Go back
      • Overview
      • Patent offices of member states
      • Other patent offices
      • Directories of patent attorneys
      • Patent databases, registers and gazettes
      • Disclaimer
    • Contact us
      • Go back
      • Overview
      • Filing options
      • Locations
    • Subscription centre
      • Go back
      • Overview
      • Subscribe
      • Change preferences
      • Unsubscribe
    • Official holidays
    • Glossary
    • RSS feeds
Board of Appeals
Decisions

Recent decisions

Overview
  • 2025 decisions
  • 2024 decisions
  • 2023 decisions
  1. Home
  2. W 0012/01 (Identification of bacteria/KING'S COLLEGE et al) 29-10-2003
Facebook X Linkedin Email

W 0012/01 (Identification of bacteria/KING'S COLLEGE et al) 29-10-2003

European Case Law Identifier
ECLI:EP:BA:2003:W001201.20031029
Date of decision
29 October 2003
Case number
W 0012/01
Petition for review of
-
Application number
PCT/GB2000/00740
IPC class
-
Language of proceedings
EN
Distribution
DISTRIBUTED TO BOARD CHAIRMEN (C)

Download and more information:

Decision in EN 43.55 KB
Documentation of the appeal procedure can be found in the European Patent Register
Bibliographic information is available in:
EN
Versions
Unpublished
Application title

Identification of bacteria

Applicant name
KING'S COLLEGE LONDON GUY'S & ST. THOMAS'S NATIONAL HEALTH TRUST
Opponent name
-
Board
3.3.04
Headnote
-
Relevant legal provisions
Patent Cooperation Treaty Art 17(3)(a)
Patent Cooperation Treaty Art 34(3)
Patent Cooperation Treaty Art 34(3)(a)
Patent Cooperation Treaty R 13(1)
Patent Cooperation Treaty R 13(2)
Patent Cooperation Treaty R 13(3)
Patent Cooperation Treaty R 40(1)
Patent Cooperation Treaty R 68(2)
Patent Cooperation Treaty R 68(3)(c)
Keywords
Lack of unity a posteriori (no)
Catchword
-
Cited decisions
G 0001/89
W 0013/87
W 0011/89
W 0004/94
Citing decisions
-

I. The Applicant filed international patent application PCT/GB00/00740 on 1 March 2000. The application contained 27 claims:

"1. A method for identifying bacteria in a sample which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s)

5'GCGATTTCYGAAYGGGGRAACCC

the other primer consisting essentially of DNA having the sequence

5'TTCGCCTTTCCCTCACGGTACT

and testing the resulting amplicon by hybridisation to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample.

2. Method according to claim 1, in which at least 8 bacterial species are tested for.

3. Method according to claim 2, in which the organisms tested for comprise at least one of Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp, Pneumococci, and coagulase negative Staphylococci.

4. Method according to claim 1, in which at least 10 bacterial species are tested for.

5. Method according to claim 4, in which the organisms tested for comprise at least one of Pseudomonas aeruginosa, Proteus mirabilis, Enterococcus feacium, Enterococcus feacalis, Staphylococcus aureus, coagulase negative Staphylococcus, Listeria species, Stenotrophomonas maltophilia , Burkholderia cepacia, and Escherichia coli.

6. A method according to claim 1, in which the oligonucleotide probe or probes has/have a sequence(s) selected from the group consisting of SEQ ID Nos 3-7, 9-13, 15-19, 21-28, 30-32, 39-41, 44-49, 51, and 53-58.

7. A method according to claim l, in which the oligonucleotide probe or probes has/have a sequence(s) selected from the group consisting of SEQ ID Nos 8, 14, 20, 29, 33-38, 42, 43, 50, 52, and 59.

8. A method according to claim 1, in which the oligonucleotide probe or probes has/have a sequence(s) selected from the group consisting of SEQ ID Nos 3-59.

9. A method according to claim 1, in which the oligonucleotide probe or probes has/have a sequence(s) selected from the group consisting of SEQ ID Nos 60-63.

10. A method according to any of claims 1 to 9, in which amplification is carried out by the polymerase chain reaction (PCR)

11. A method according to any of claims 1 to 9, in which amplification is carried out by transcription mediated amplification.

12. A method according to any of the preceding claims, in which a plurality of oligonucleotide probes are used attached to a support material.

13. A degenerate primer set essentially comprising DNA having the sequences 5'GCGATTTCYGAAYGGGGRAACCC

14. A primer consisting essentialiy of DNA having the sequence 5'TTCGCCTTTCCCTCACGGTACT

15. A DNA sequence according to claim 13 or 14, being a labelled sequence.

16. A Digoxigenin-labelled DNA sequence according to claim 15.

17. One or more oligonucleotides consisting essentially of one or more DNA molecules having sequences specified in claim 6.

18. One or more oligonucleotides consisting essentially of one or more DNA molecules having sequences specified in claim 7.

19. One or more oligonucleotides consisting essentially of one or more DNA molecules having sequences specified in claim 8.

20. One or more oligonucleotides consisting essentially of one or more DNA molecules having sequences specified in claim 9.

21. One or more oligonucleotides according to any of claims 17 to 20, immobilised on a solid carrier.

22. A solid support material carrying one or more oligonucleotide probes as specified in claims 6, 7, 8, or 9.

23. A support material according to claim 22, in which some or all of the probes are attached to the substrate by means of chemically modified or additional bases.

24. A support material according to claim 23, in which additional thymine bases have been attached to the 3 prime end of the probe to increase hybridization intensity.

25. A diagnostic kit for the identification of bacteria comprising one or more amplification primers specified in claim 1.

26. A diagnostic kit for the identification of bacteria comprising one or more oligonucleotide probes as specified in claim 6, 7 , 8, or 9.

27. A diagnostic kit for the identification of bacteria comprising a solid support material carrying one or more oligonucleotide probes as specified in claim 6, 7, 8, or 9."

II. On 17 July 2000, the EPO, acting as International Searching Authority (ISA), issued to the Applicant an invitation to pay twenty four additional search fees in accordance with Article 17(3)(a) and Rule 40.1 PCT because it considered that the international application covered the twenty five groups of inventions below:

1. Claims: 13-16, 25 (complete); 1-6, 8, 10-12, 17, 19, 21-24, 26, 27 (partial)

INVENTION 1:

A primer set, suitable for amplification of bacterial 23S rRNA comprising such a sequence, an oligonucleotide probe according to SEQ ID Nos. 3 to 4, suitable for detecting Proteus species, a solid support material carrying such probe(s), a diagnostic kit comprising such primers and/or probe(s), as well as a method of identifying bacteria using such primers and probe(s).

2. Claims: 1 to 8, 10 to 12, 17 to 19, 21 to 24, 26, 27 (partial)

INVENTION 2:

An oligonucleotide probe according to SEQ ID Nos. 5, 8, 10, 37, 48, suitable for detecting E. coli species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

3. Claims: 1 to 4, 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 3:

An oligonucleotide probe according to SEQ ID Nos. 6, 7, suitable for detecting Klebsiella species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

4. Claims: 1 to 8, 10 to 12, 17 to 19, 21 to 24, 26, 27 (partial)

INVENTION 4:

An oligonucleotide probe according to SEQ ID Nos. 9, 38, 49, suitable for detecting Enterobacter species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

5. Claims: 1, 2, 4, 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 5:

An oligonucleotide probe according to SEQ ID No. 11, suitable for detecting Salmonella species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

6. Claims: 1, 2, 4, 6 to 8, 10 to 12, 17 to 19, 21 to 24, 26, 27 (partial)

INVENTION 6:

An oligonucleotide probe according to SEQ ID Nos. 12, 15, 18, 30 to 35, suitable for detecting Streptococcus species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

7. Claims: 1 to 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 7:

An oligonucleotide probe according to SEQ ID No. 13, suitable for detecting Pseudomonas species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

8. Claims: 1, 2, 4, 7, 8, 10 to 12, 18, 19, 21 to 24, 26, 27 (partial)

INVENTION 8:

An oligonucleotide probe according to SEQ ID No. 14, suitable for detecting Haemophilus species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

9. Claims: 1 to 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 9:

An oligonucleotide probe according to SEQ ID Nos. 16, 19, suitable for detecting Enterococcus species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

10. Claims: 1, 2, 4, 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 10:

An oligonucleotide probe according to SEQ ID No. 17, suitable for detecting Aeromonas species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

11. Claims: 1 to 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 11:

An oligonucleotide probe according to SEQ ID Nos. 20 to 26, suitable for detecting Staphylococcus species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

12. Claims: 1, 2, 4 to 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 12:

An oligonucleotide probe according to SEQ ID No. 27, suitable for detecting Burkholderia species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

13. Claims: 1, 2, 4, 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 13:

An oligonucleotide probe according to SEQ ID No. 28, suitable for detecting Stenotrophomonas species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

14. Claims: 1, 2, 4, 5, 7, 8, 10 to 12, 18, 19, 21 to 24, 26, 27 (partial)

INVENTION 14:

An oligonucleotide probe according to SEQ ID No. 29, suitable for detecting Listeria species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

15. Claims: 1, 2, 4, 7, 8, 10 to 12, 18, 19, 21 to 24, 26, 27 (partial)

INVENTION 15:

An oligonucleotide probe according to SEQ ID No. 36, suitable for detecting Acinetobacter species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

16. Claims: 1, 2, 4, 6 to 8, 10 to 12, 17 to 19, 21 to 24, 26, 27 (partial)

INVENTION 16:

An oligonucleotide probe according to SEQ ID Nos. 38, 39, suitable for detecting CNS species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

17. Claims: 1, 2, 4, 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 17:

An oligonucleotide probe according to SEQ ID No. 41, suitable for detecting Plesiomonas species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

18. Claims: 1, 2, 4, 7 to 12, 18 to 24, 26, 27 (partial)

INVENTION 18:

An oligonucleotide probe according to SEQ ID Nos. 42, 43, 60, 61, suitable for detecting Neisseria species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

19. Claims: 1, 2, 4, 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 19:

An oligonucleotide probe according to SEQ ID Nos. 44, 45, suitable for detecting Campylobacter species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

20. Claims: 1, 2, 4, 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 20:

An oligonucleotide probe according to SEQ ID No. 46, suitable for detecting Helicobacter species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

21. Claims: 1, 2, 4, 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 21:

An oligonucleotide probe according to SEQ ID No. 47, suitable for detecting Ralstonia species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

22. Claims: 1, 2, 4, 6 to 12, 17 to 24, 26, 27 (partial)

INVENTION 22:

An oligonucleotide probe according to SEQ ID Nos. 50 to 52, 62, 63, suitable for detecting Chlamydia species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

23. Claims: 1, 2, 4, 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 23:

An oligonucleotide probe according to SEQ ID No. 53, suitable for detecting Coxiella species, a solid support material carrying such probe, a diagnostic kit comprising such probe, as well as an amplification method of identifying bacteria using such probe.

24. Claims: 1, 2, 4, 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 24:

An oligonucleotide probe according to SEQ ID Nos. 54, 55, suitable for detecting Rhodococcus species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

25. Claims: 1, 2, 4, 6, 8, 10 to 12, 17, 19, 21 to 24, 26, 27 (partial)

INVENTION 25:

An oligonucleotide probe according to SEQ ID Nos. 56 to 58, suitable for detecting Mycobacterium species, a solid support material carrying such probes, a diagnostic kit comprising such probe(s), as well as an amplification method of identifying bacteria using such probe(s).

III. The ISA reasoned their invitation to pay the additional fees that oligonucleotide primers suitable for amplifying "universal" or "consensus" parts of bacterial rRNA genes, especially deriving from bacterial 23S genes, species-specific oligonucleotide detection probes, as well as (multiplex) methods combining such primers and probes for the purpose of identifying bacterial species within a sample were already known in the prior art represented by:

(D1) EP-A-0395292;

(D2) Lew. A.E. et al., J. Clin. Microbiol., Vol. 32, No. 5, pages 1326 o 1332 (1994); and

(D3) W0-A-96/00298.

Document (D1) disclosed "universal" primers for amplifying conserved genomic 16S- and 23S-rDNA regions of numerous phylogenetically related microorganisms, followed by species identification via the use of species-specific probes. Likewise, document (D2) disclosed detection of Pseudomonas species by PCR using primers directed against conserved parts of the 23S rDNA gene, followed by hybridization with strain-specific probes, whereas document (D3) described multiplex detection of microorganisms within a sample by amplification of the 16S-23S rRNA spacer region, followed by detection with taxon-specific probes.

IV. In the ISA's view, the problem solved by the application vis-à-vis this prior could be defined as the provision of further alternative consensus oligonucleotide amplification primers (SEQ ID Nos. 1, 2) and oligonucleotide detection probes (SEQ ID Nos. 3 to 63), suitable within a method for (multiplex) detection of bacterial species within a sample. However, each of the 61 detection probes having each a different primary structure and a different species specificity in combination with the disclosed primer set represented an independent solution concerning the problem of the underlying application, taking into account the fact that no other technical features could be distinguished which, in the light of the prior art, could be regarded as special technical features common to these solutions, pursuant to Article 17(3)(a) PCT.

V. Nevertheless, taking into account the balance between necessary search effort and the levying of additional fees, the ISA decided to combine probes referring to the same bacterial species (Proteus, E. coli, Klebsiella, Enterobacter, Salmonella, Streptococcus, Pseudomanas, Haemophilus, Enterococcus, Aeromonas, Staphylococcus, Burkholderia, Stenotrophomonas, Listeria, Acinetobacter, CNS (coagulase negative Streptococcus), Plesiomonas, Neisseria, Campylobacter, Helicobacter, Ralstonia, Chlamydia, Coxiella, Rhodococcus and Mycobacterium) into one group of invention, so that the application comprised a plurality of 25 (groups of) inventions.

VI. With its response of 16 August 2000, the Applicant paid under protest nine additional search fees for the search of the inventions identified by the ISA as 2, 3, 4, 7, 9, 11, 12, 13. and 14 and presented arguments that the inventions identified as 1 to 25 (see Section II supra) were unitary, because, inter alia, all the probes hybridized to the particular portions of the 23S rDNA defined by the primers according to SEQ ID Nos. 1 and 2.

VII. With a communication dated 12 October 2000, a review board within the meaning of Rule 68.3(c) PCT confirmed the ISA's opinion regarding lack of unity. It was pointed out by the review board that the "down" primer with SEQ ID No. 156 disclosed on page 64 of document (D3) primed at the same site as the "second" primer with SEQ ID No. 2 referred to in present claim 1 and that, therefore, the specific probes according to document (D3) originated from the same region as in the present application. Furthermore, the review panel reconsidered the number of additional search fees to be requested, reducing it to three. Consequently, refund of six of the nine additionally paid search fees was ordered.

VIII. The Applicant requested reimbursement of the additional search fees, and of the protest fee.

1. The protest is admissible.

2. According to Rule 13.1 PCT, the international patent application shall relate to one invention only or to a group of inventions so linked as to form a single inventive concept. If the ISA considers that the claims lack this unity, it is empowered, under Article 17(3)(a) and Rule 40.2 PCT, to invite the Applicant to pay additional fees.

3. Lack of unity may be directly evident a priori, ie before the examination of the merits of the claims in comparison with the state of the art revealed by the search (cf., for example, decision W 13/87 of 9 August 1988). Alternatively, having regard to decision G 1/89 of the Enlarged Board of Appeal (EBA) (OJ EPO 1991, 155), the ISA is also empowered to raise an objection a posteriori, ie after having taken the prior art revealed by the search into closer consideration. This practice is laid down in the PCT/International Search Guidelines, Chapter VII: 9. (PCT Gazette Special Issue 66/1998) which are the basis for a uniform practice of all International Searching Authorities. The Enlarged Board of Appeal indicated that such considerations represent only a provisional opinion on novelty and inventive step which are in no way binding upon the authorities subsequently responsible for the substantive examination of the application (point 8.1. of the reasons). In point 8.2 of the reasons, the EBA mentioned that such invitation to pay additional fees should always be made "with a view to giving the Applicant fair treatment" and should only be made in clear cases.

4. According to Rule 13.3 PCT, the determination whether a group of inventions is so linked as to form a single general inventive concept shall be made without regard to whether the inventions are claimed in separate claims or as alternatives within a single claim.

5. The ISA has based its finding of lack of unity upon a posteriori considerations (see sections III and IV above). They found that "the common inventive concept" underlying the present claims, in the light of the prior art, could only be seen in the provision of further alternative consensus oligonucleotide amplification primers (SEQ ID Nos. 1, 2) and oligonucleotide detection probes (SEQ ID Nos. 3 to 63), suitable within a method for (multiplex) detection of bacterial species within a sample. However, firstly the ISA came to the conclusion that each of the 61 detection probes (SEQ ID Nos. 3 to 63) having each a different primary structure and a different species specificity in combination with the disclosed primer set represented an independent solution concerning the problem of the underlying application, resulting in 61 separate inventions. The ISA "has taken the decision to combine probe referring to the same bacterial species into one group of invention" (see invitation of 17. July 2000, point 5) resulting in 25 inventions. The Review panel finally used its discretion (PCT International Search Guidelines IV-VII-12) to reduce the number of fees to three.

6. In order to define the underlying technical problem to be solved by the present application the disclosure of documents (D1) to (D3) has to be taken into consideration.

7. Document (1) relates, inter alia, to a method as that of the application, however, the two "universal" primers, distant about 100 to 120 bp, flank either the V2 (primers R1 and R2) or the V6 (primers U1 and U2) variable regions of the 16S rDNA (see page 9, line 37 to page 10, line 6). Apparently, the "V2 system" (primers R1 and R2) enables amplification of the DNA of (only) seven bacteria species, as does the "V6" one (primers U1 and U2) (see page 10, lines 8 to 22), compared with the 80 bacteria species of the present application (see Table 1 on pages 19 to 20) involving only two primers.

8. Primers PPMA and PPMC disclosed in document (2) are distant 1,550 bp and have been chosen from the 23S rDNA region (see Figure 1 and legend thereto). However, they have been designed by comparing the 23S rRNA sequences of Pseudomonas cepacia with that of Pseudomonas aeruginosa, ie only two bacteria of the same species (see page 1327, left-hand column). There is no disclosure, however, that these primers are "universal" in the sense that they enable amplification of DNAs from bacterial species different from Pseudomonas.

9. As for document (3), it relates to a method for identifying bacteria in a sample. The review board concluded (see section VII supra) that the "down" primer with SEQ ID No. 156 disclosed on page 64 of document (D3) primed at the same site as the "second" primer with SEQ ID No. 2 referred to in present claim 1 and that, therefore, the specific probes according to document (D3) originated from the same region as in the present application. The board agrees that the "lower" primer with SEQ ID No. 156 5'CCTTTCCCTCACGGTACT (see page 64, line 20) almost coincides with the "second" primer 5'TTCGCCTTTCCCTCACGGTACT of claim 1 of the present application. However, the following two differences are worth to be noted: (i) the "upper" primer with SEQ ID No. 155 hybridizes in the 16S-23S rRNA spacer region, not in the 23S rDNA region and (ii) the specific probes according to document (D3) originate from the 16S-23S rRNA spacer region (see eg page 65, line 7: "from the nucleic acid of the spacer from..."), ie a different region compared with the present application. The latter acknowledges that "the 16S 23S rDNA spacer region is highly variable within many species" (page 2, lines 5 to 6). The method according to document (D3) further differs from that of the present application in that it contemplates the additional 14 primers listed in claims 43 to 45. of this document. Thus, use is not made of only one pair of "universal primers".

10. The present application describes a method for identifying bacteria in a sample which comprises amplifying a portion of the 23S rDNA region of bacteria present in the sample by means of two "universal" primers distant about 390 to 420 bp (see page 14, lines 11 to 12) and testing the resulting amplicon by hybridisation to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. In view of the above, the board can agree neither to the finding by the ISA that the prior art already discloses "universal" or "consensus" oligonucleotide primers deriving from bacterial 23S genes, nor to the ISA's conclusion that the technical problem solved by the claimed subject-matter lies with the provision of further alternative consensus oligonucleotide amplification primers (SEQ ID Nos. 1, 2) and oligonucleotide detection probes (SEQ ID Nos. 3 to 63), suitable for (multiplex) detection of bacterial species within a sample. Rather, these consensus oligonucleotide amplification primers (SEQ ID Nos. 1, 2) being a specific sequence of the 23S rDNA region and the oligonucleotide detection probes (SEQ ID Nos. 3 to 63) (the latter all bind to the 390-420 bp long 23S rDNA region delimited by the two primers 5'GCGATTTCYGAAYGGGGRAACCC and 5'TTCGCCTTTCCCTCACGGTACT recited in present claim 1) represent the solution to the problem set out in the present application (see page 2, lines 14 to 17) of finding a region of the rDNA gene which enables identifying a large number of different bacteria by means of only two primers.

11. Given the novelty of the solution defined in the claims, in order to conclude that there is nevertheless a lack of feature linking the solutions defined in the claims justifying the finding of non-unity of the invention, an examination of the inventive step would be necessary. However, the board only has to examine whether considering the reason given by the ISA retaining the additional fees as justified and it cannot investigate ex officio whether an objection of lack of unity would have been justified for reasons other than those given (see W 4/94, OJ EPO 1996, 74, point 5.5 of the reasons). Since the reasons given in the ISA's invitation for finding non- unity were only based on lack of novelty, the protest is justified to the full extent and the remaining additional search fees and the protest fee must be refunded.

Order

ORDER

For these reasons it is decided that:

Refund of the additional search fees and of the protest fee paid by the Applicant is ordered.

Footer - Service & support
  • Service & support
    • Website updates
    • Availability of online services
    • FAQ
    • Publications
    • Procedural communications
    • Contact us
    • Subscription centre
    • Official holidays
    • Glossary
Footer - More links
  • Jobs & careers
  • Press centre
  • Single Access Portal
  • Procurement
  • Boards of Appeal
Facebook
European Patent Office
EPO Jobs
Instagram
EuropeanPatentOffice
Linkedin
European Patent Office
EPO Jobs
EPO Procurement
X (formerly Twitter)
EPOorg
EPOjobs
Youtube
TheEPO
Footer
  • Legal notice
  • Terms of use
  • Data protection and privacy
  • Accessibility