G 0002/10 (Disclaimer/SCRIPPS) of 30.8.2011

European Case Law Identifier: ECLI:EP:BA:2011:G000210.20110830
Datum der Entscheidung: 30 August 2011
Aktenzeichen: G 0002/10
Vorlageentscheidung: T 1068/07
Anmeldenummer: 98920015.9
IPC-Klasse: C12Q 1/68
Verfahrenssprache: EN
Verteilung: A
Download und weitere Informationen:
Text der Entscheidung in DE (PDF, 86.926K)
Alle Dokumente zum Beschwerdeverfahren finden Sie im Register
Bibliografische Daten verfügbar in: DE | EN | FR
Fassungen: OJ
Bezeichnung der Anmeldung: -
Name des Anmelders: THE SCRIPPS RESEARCH INSTITUTE
Name des Einsprechenden: -
Kammer: EBA
Leitsatz: Die der Großen Beschwerdekammer vorgelegte Rechtsfrage wird wie folgt beantwortet:
1a. Die Änderung eines Anspruchs durch Aufnahme eines Disclaimers, der einen in der ursprünglich eingereichten Fassung der Anmeldung offenbarten Gegenstand ausklammert, verstößt gegen Artikel 123 (2) EPÜ, wenn der nach Aufnahme des Disclaimers im Patentanspruch verbleibende Gegenstand dem Fachmann, der allgemeines Fachwissen heranzieht, nicht in der ursprünglich eingereichten Fassung der Anmeldung unmittelbar und eindeutig offenbart wird, sei es implizit oder explizit.
1b. Ob dies der Fall ist, muss anhand einer technischen Beurteilung aller technischen Umstände des jeweiligen Einzelfalls bestimmt werden, bei der es Art und Umfang der Offenbarung in der ursprünglich eingereichten Fassung der Anmeldung, Art und Umfang des ausgeklammerten Gegenstands sowie dessen Verhältnis zu dem nach der Änderung im Anspruch verbleibenden Gegenstand zu berücksichtigen gilt.
Relevante Rechtsnormen:
European Patent Convention Art 54(2)
European Patent Convention Art 54(3)
European Patent Convention Art 56
European Patent Convention Art 61(1)(b)
European Patent Convention Art 76(1)
European Patent Convention Art 83
European Patent Convention Art 84
European Patent Convention Art 87(1)
European Patent Convention Art 123(2)
European Patent Convention Art 123(3)
Napp Pharmaceutical Holdings Ltd v. Ratiopharm GmbH and Sandoz Ltd, Court of Appeal (England and Wales), [2009] EWCA Civ 252
Mundipharma Pharmaceuticals B.V. v. Sandoz B.V., District Court of The Hague of 7 April 2010, case no. 340373/09-2029
Schlagwörter: Zulässigkeit der Vorlage (bejaht)"
Auslegung der Vorlagefrage - Begriff "Disclaimer" - Gegenstand statt Ausführungsform
G 1/03 und G 2/03 betreffen Disclaimer für offenbarten Gegenstand (verneint)
Allgemeine Definition für die Prüfung nach Artikel 123 (2) EPÜ - Anwendung auf Disclaimer für offenbarten Gegenstand (bejaht)
Referenzpunkt: im Patentanspruch verbleibender Gegenstand
Technische Beurteilung der Gesamtumstände des Falls erforderlich - gleicher Test wie für positive Merkmale
Durch Disclaimer ausgeklammerter Gegenstand als Teil der Erfindung offenbart - nicht relevant
Wichtigkeit eines einheitlichen Offenbarungskonzepts und einer einheitlichen Bestimmung der daraus ableitbaren Rechte
Orientierungssatz:

-

Angeführte Entscheidungen:
G 0003/89
G 0011/91
G 0001/93
G 0002/98
G 0001/03
G 0002/03
G 0001/05
G 0001/06
G 0001/07
T 0004/80
T 0313/86
T 0170/87
T 0448/93
T 0615/95
T 0323/97
T 0451/99
T 0507/99
T 1050/99
T 1102/00
T 1139/00
T 1107/06
Anführungen in anderen Entscheidungen:
G 0002/12
G 0002/13
G 0001/15
G 0001/16
R 0008/13
R 0003/17
R 0006/18
T 1242/06
T 1068/07
T 1170/07
T 0971/08
T 1049/08
T 1870/08
T 1911/08
T 2018/08
T 2165/08
T 0302/09
T 0748/09
T 0964/09
T 1042/09
T 1045/09
T 1157/09
T 1176/09
T 1393/09
T 1447/09
T 1457/09
T 1510/09
T 1779/09
T 2102/09
T 2273/09
T 0112/10
T 0303/10
T 0759/10
T 1100/10
T 1227/10
T 1246/10
T 1280/10
T 1306/10
T 1570/10
T 1643/10
T 1946/10
T 2237/10
T 2287/10
T 2457/10
T 2461/10
T 2464/10
T 2537/10
T 0015/11
T 0074/11
T 0239/11
T 0704/11
T 0831/11
T 0938/11
T 1147/11
T 1151/11
T 1222/11
T 1226/11
T 1229/11
T 1247/11
T 1365/11
T 1651/11
T 1830/11
T 1839/11
T 1840/11
T 2130/11
T 2506/11
T 2561/11
T 2585/11
T 2618/11
T 0046/12
T 0102/12
T 0248/12
T 0336/12
T 0351/12
T 0401/12
T 0442/12
T 0447/12
T 0461/12
T 0562/12
T 0598/12
T 0632/12
T 0831/12
T 1329/12
T 1363/12
T 1436/12
T 1472/12
T 1525/12
T 1580/12
T 1720/12
T 1791/12
T 2043/12
T 2174/12
T 2314/12
T 2599/12
T 0078/13
T 0389/13
T 0557/13
T 0558/13
T 0560/13
T 0589/13
T 0606/13
T 0637/13
T 0802/13
T 0850/13
T 0865/13
T 0872/13
T 0945/13
T 1007/13
T 1085/13
T 1149/13
T 1165/13
T 1267/13
T 1279/13
T 1319/13
T 1441/13
T 1548/13
T 1634/13
T 1678/13
T 1710/13
T 1808/13
T 1825/13
T 1852/13
T 1856/13
T 2002/13
T 2089/13
T 2119/13
T 2415/13
T 2418/13
T 2440/13
T 0060/14
T 0076/14
T 0213/14
T 0330/14
T 0343/14
T 0437/14
T 0894/14
T 1156/14
T 1224/14
T 1308/14
T 1318/14
T 1319/14
T 1458/14
T 1775/14
T 1810/14
T 1856/14
T 1872/14
T 1955/14
T 2046/14
T 2171/14
T 0046/15
T 0137/15
T 0156/15
T 0159/15
T 0262/15
T 0314/15
T 0553/15
T 0588/15
T 0628/15
T 0734/15
T 0916/15
T 1112/15
T 1141/15
T 1150/15
T 1302/15
T 1354/15
T 1469/15
T 1528/15
T 1689/15
T 2000/15
T 2100/15
T 2115/15
T 2160/15
T 0085/16
T 0152/16
T 0189/16
T 0210/16
T 0278/16
T 0413/16
T 0422/16
T 0703/16
T 0782/16
T 0903/16
T 0921/16
T 1089/16
T 1131/16
T 1259/16
T 1753/16
T 2351/16
T 1125/17
T 1438/17
T 0774/18

Sachverhalt und Anträge

I. Vorlagefrage

Die Technische Beschwerdekammer 3.3.08 legte mit ihrer Zwischenentscheidung T 1068/07 vom 25. Juni 2010 der Großen Beschwerdekammer folgende Frage vor:

Verstößt ein Disclaimer gegen Artikel 123 (2) EPÜ, wenn sein Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung als Ausführungsform der Erfindung offenbart war?

II. Angefochtene Entscheidung der Prüfungsabteilung

Gegenstand des Beschwerdeverfahrens vor der vorlegenden Kammer ist die Beschwerde der Beschwerdeführerin gegen die Entscheidung der Prüfungsabteilung vom 2. Februar 2007, mit der die europäische Patentanmeldung Nr. 98 920 015.9 zurückgewiesen wurde. Die Prüfungsabteilung hatte befunden, dass sowohl der Hauptantrag als auch der (erste) Hilfsantrag der Anmelderin den Erfordernissen des Artikels 123 (2) EPÜ nicht genügten. Die in Anspruch 1 aufgenommenen Disclaimer hätten keine Grundlage in der ursprünglich eingereichten Fassung der Anmeldung.

III. Der Vorlageentscheidung zugrunde liegende Ansprüche

Die Anmeldung bezieht sich auf katalytische (enzymatische) DNA-Moleküle, die andere Nukleinsäuresequenzen oder -moleküle, insbesondere RNA, ortsspezifisch spalten können.

Anspruch 1 des Hauptantrags lautet wie folgt:

"Katalytisches DNA-Molekül mit ortsspezifischer Endonukleaseaktivität, die spezifisch ist für eine Nukleotidsequenz, die eine Spaltstelle in einer vorausgewählten Substratnukleinsäuresequenz definiert,

wobei das katalytische Molekül eine erste und eine zweite Substratbindungsregion aufweist, die eine Kernregion flankieren,

wobei das Molekül folgende Formel hat:

5' (X-R) - GGCTAGCT8ACAACGA - (X) 3'

in der

jedes X eine beliebige Nukleotidsequenz ist,

(X-R) für die erste Substratbindungsregion steht,

(X) für die zweite Substratbindungsregion steht,

R ein Nukleotid ist, das ein Basenpaar mit einem Pyrimidin in der vorausgewählten Substratnukleinsäuresequenz bilden kann,

T8 durch C oder A ersetzt werden kann,

wobei die erste Substratbindungsregion eine Sequenz hat, die durch komplementäre Basenpaarung an einen ersten Bereich der vorausgewählten Substratnukleinsäuresequenz binden kann,

wobei die zweite Substratbindungsregion eine Sequenz hat, die durch komplementäre Basenpaarung an einen zweiten Bereich der vorausgewählten Substratnukleinsäuresequenz binden kann,

wobei die erste Substratbindungsregion nicht die Sequenz 5' CTTTGGTTA 3' oder 5' CTAGTTA 3' hat,

wobei die zweite Substratbindungsregion nicht die Sequenz 5' TTTTTCC 3' hat und wobei das katalytische DNA-Molekül keine ortsspezifische Endonukleaseaktivität für die folgende Sequenz aufweist:

5' - GGAAAAAGUAACUAGAGAUGGAAG - 3' (SEQ ID NO 135)."

(Hervorhebung durch die Große Beschwerdekammer)

Der Hilfsantrag I der Beschwerdeführerin lautete, was Anspruch 1 betrifft, wie der Hauptantrag, außer dass in Anspruch 1 der Hinweis aus Anspruch 2 aufgenommen wurde, dass "R" für A oder G steht.

Die Hilfsanträge II und III der Beschwerdeführerin, die bei der vorlegenden Kammer auf eine Mitteilung dieser Kammer hin eingereicht wurden, lauteten, was Anspruch 1 betrifft, wie der Hauptantrag, bis auf den Unterschied, dass der Schlussteil von Anspruch 1 des Hauptantrags, nämlich: "wobei die erste Substratbindungsregion nicht die Sequenz [...] (SEQ ID NO 135) hat", durch einen Wortlaut ersetzt wurde, der im Hilfsantrag II wie folgt lautet:

"... mit der Maßgabe, dass das katalytische Molekül kein Molekül ist, in dem die erste und die zweite Bindungsregion durch komplementäre Basenpaarung an die folgende Substratnukleinsäure binden können:

5' - GGAAAAAGUAACUAGAGAUGGAAG - 3' (SEQ ID NO 135)"

und der im Hilfsantrag III wie folgt lautet:

"... mit der Maßgabe, dass das katalytische Molekül kein Molekül ist, das eine ortsspezifische intermolekulare katalytische Spaltung des Substrats

5' - GGAAAAAGUAACUAGAGAUGGAAG - 3' (SEQ ID NO 135)

bei 2 mM MgCl2, 150 mM KCl, pH 7,5, 37°C und einer Rate von etwa kcat = 0,01 min-1 aufweist."

IV. Entscheidung der Prüfungsabteilung

Die Prüfungsabteilung hatte den Hauptantrag und den ersten Hilfsantrag der Anmelderin (Beschwerdeführerin) mit der Begründung zurückgewiesen, dass der darin enthaltene Disclaimer in der ursprünglich eingereichten Fassung der Anmeldung nicht als solcher offenbart sei und die Erfordernisse der Entscheidungen G 1/03 und G 2/03 (ABl. EPA 2004, 413 und 448, nachstehend: Entscheidung G 1/03, sofern nicht ausdrücklich etwas anderes angegeben ist) nicht erfüllt seien. Die Disclaimer dienten dazu, dem Gegenstand des Anspruchs 1 Neuheit nach Artikel 54 (2) EPÜ gegenüber D1 zu verleihen, D1 sei aber eindeutig demselben Fachgebiet zuzuordnen, denn es betreffe ebenfalls katalytische DNA-Moleküle. Daher sei D1 nicht so unerheblich für die beanspruchte Erfindung und liege nicht so weitab von ihr, dass der Fachmann diese Vorveröffentlichung bei der Erfindung nicht berücksichtigt hätte. Erfinder und Anmelder seien bei D1 außerdem dieselben wie bei der Streitanmeldung, und D1 sei inhaltlich großteils identisch mit der Anmeldung.

V. Vorlageentscheidung

Die vorlegende Kammer ist der Auffassung, dass Anspruch 1 des Hauptantrags und des Hilfsantrags I der Beschwerdeführerin gegen Artikel 123 (2) EPÜ verstößt. Diese Ansprüche würden durch "drei negative Merkmale" eingeschränkt, die in der ursprünglich eingereichten Fassung der Anmeldung nicht offenbart seien. Der durch die negativen Merkmale bewirkte Ausschluss der spezifischen (ersten und zweiten) Substratbindungsarme und der spezifischen Substratsequenz des Prototypmotivs "10-23" (vgl. Abbildungen 8 und 9) aus dem Schutzbereich von Anspruch 1 sei eine Auswahl aus der größeren Bandbreite der in Beispiel 6, insbesondere auf Seite 87, Zeilen 24 - 28, vorgeschlagenen Änderungen. Für diese Auswahl finde sich in der ursprünglich eingereichten Fassung der Anmeldung keine unmittelbare und eindeutige Stütze (s. Nr. 11 der Entscheidungsgründe).

Im Gegensatz dazu seien in den Hilfsanträgen II und III die Anspruch 1 der vorhergehenden Anträge charakterisierenden negativen Merkmale durch Disclaimer ersetzt worden, deren Gegenstand als eine Ausführungsform der Erfindung offenbart gewesen sei.

Wie Nummer 4.2.3 der Entscheidung G 1/07 zu entnehmen sei, seien im Anschluss an die Entscheidung G 1/03, die sich mit dem Thema der sogenannten nicht offenbarten Disclaimer befasse, in der Rechtsprechung der Beschwerdekammern unterschiedliche Auffassungen dazu vertreten worden, ob sich die in diesen Entscheidungen getroffenen Feststellungen der Großen Kammer auch auf Disclaimer bezögen, mit denen Ausführungsformen ausgeklammert würden, die in der ursprünglich eingereichten Fassung der Anmeldung als Teil der Erfindung offenbart seien. In dem bei der vorlegenden Kammer anhängigen Verfahren mache es einen entscheidenden Unterschied, ob der erste Ansatz verfolgt werde oder der zweite. Im ersten Fall müssten die Hilfsanträge II und III nach Artikel 123 (2) EPÜ zurückgewiesen werden, was die Zurückweisung der Beschwerde zur Folge hätte. Im zweiten Fall würden diese Anträge nicht gegen Artikel 123 (2) EPÜ verstoßen, und die angefochtene Entscheidung könne aufgehoben werden.

VI. Verfahren vor der Großen Beschwerdekammer

Mit Entscheidung vom 6. August 2010 forderte die Große Beschwerdekammer den Präsidenten des EPA auf, sich zu der vorgelegten Rechtsfrage schriftlich zu äußern, und lud auch die Öffentlichkeit ein, Stellungnahmen einzureichen. Der Präsident des EPA und mehrere Dritte haben schriftliche Stellungnahmen eingereicht. Am 18. März 2011 versandte die Große Beschwerdekammer eine Ladung zur mündlichen Verhandlung und am 21. Juni 2011 eine Mitteilung, in der sie auf verschiedene Punkte hinwies, die für die Erörterung in der mündlichen Verhandlung von besonderer Bedeutung zu sein schienen. Die mündliche Verhandlung fand am 4. August 2011 statt. Am Ende der mündlichen Verhandlung verkündete der Vorsitzende, dass die Entscheidung der Großen Beschwerdekammer in schriftlicher Form ergehen werde.

VII. Vorbringen der Beschwerdeführerin

Das Vorbringen der Beschwerdeführerin lässt sich wie folgt zusammenfassen:

Die Entscheidung G 1/03 finde auf Disclaimer, die offenbarte Ausführungsformen ausklammerten, keine Anwendung. Die rechtliche Analyse der Großen Beschwerdekammer in der Entscheidung G 1/03 sei durch die ihr gestellten Fragen bestimmt worden. Diese Fragen hätten nicht die Prüfung des Falls umfasst, in dem der auszuschließende Gegenstand nur durch eine positive Formulierung offenbart werde. Auch die Art und Weise, wie die Große Beschwerdekammer definiere, wie der Disclaimer formuliert werden sollte (Nr. 3 der Entscheidungsgründe), nämlich, dass er nicht mehr ausklammern solle, als notwendig sei, um die Neuheit wiederherzustellen oder den aus nichttechnischen Gründen vom Patentschutz ausgenommenen Gegenstand auszuschließen, zeige, dass G 1/03 nicht zur Anwendung auf Disclaimer für positiv offenbarte Ausführungsformen gedacht sei, denn im letzteren Fall sei der Wortlaut des Disclaimers durch den Wortlaut der Ausführungsform vorgegeben. Dieser Unterschied zwischen den beiden Arten von Disclaimern mache deutlich, dass sie grundverschieden seien.

Was Nummer 2.5 der Entscheidungsgründe von G 1/03 betreffe, worauf sich die Kammer in der Entscheidung T 1050/99 berufe, so rechtfertige die angeführte Passage der Entscheidung der Großen Beschwerdekammer nicht die Schlussfolgerungen der Technischen Beschwerdekammer. Nichts in diesem Abschnitt von G 1/03 deute darauf hin, dass die Große Beschwerdekammer an einen Fall gedacht habe, in dem der Disclaimer nicht in der ursprünglich eingereichten Fassung der Anmeldung offenbart sei, der von ihm ausgeschlossene Gegenstand aber schon. Vielmehr gehe es sowohl in T 170/87 als auch in T 313/86, den einzigen Entscheidungen, auf die in dieser Passage von G 1/03 im Zusammenhang mit der Ausschließung von Gegenständen verwiesen werde, um die Frage von Disclaimern, bei denen die auszuschließenden Gegenstände keine Stütze hätten.

Die Große Beschwerdekammer habe sich in der Entscheidung G 1/07 damit befasst, dass in der Rechtsprechung der Beschwerdekammern unterschiedliche Auffassungen zu diesem Thema vertreten worden seien, und habe für die Beurteilung von Disclaimern für offenbarte Ausführungsformen nur zwei Möglichkeiten definiert, nämlich

a) die Anwendung der Entscheidung G 1/03 oder

b) die Anwendung der Rechtsprechung in Anlehnung an die Entscheidung T 4/80, wie sie in T 1107/06 zusammengefasst sei. Da die Große Beschwerdekammer in G 1/07 nur zwei Alternativen genannt habe, müsse der anwendbare Ansatz derjenige sein, der in T 4/80 und den folgenden Entscheidungen einschließlich T 1107/06 definiert sei. Dieser Ansatz sei auch in der früheren, im Juni 2005 veröffentlichten Fassung der Richtlinien für die Prüfung zu finden (s. III, 4.2).

Ein Disclaimer, dessen Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung als eine Ausführungsform der Erfindung offenbart sei, verstoße nicht gegen Artikel 123 (2) EPÜ. In einem solchen Fall entstehe dem Anmelder eindeutig kein ungerechtfertigter Vorteil im Sinne der Entscheidung G 1/93 (Nr. 9 der Entscheidungsgründe), denn er beanspruche ja nur die ursprünglich offenbarte Erfindung abzüglich einer bestimmten Ausführungsform, was beides ursprünglich beschrieben worden sei. Daher könne die Rechtssicherheit für Dritte durch solch einen Disclaimer nicht gefährdet werden.

Laut der Entscheidung T 1107/06 komme es nicht darauf an, ob aus der ursprünglich eingereichten Fassung der Anmeldung geschlossen werden könne, dass der Anmelder den Gegenstand des Disclaimers habe ausklammern wollen, sondern vielmehr darauf, ob der nach der Aufnahme des Disclaimers im Anspruch verbleibende Gegenstand gestützt werde (Nr. 45 der Entscheidungsgründe). In dieser Entscheidung sei die Technische Beschwerdekammer zu dem Schluss gekommen, dass der Fachmann angesichts der allgemeinen Offenbarung der Erfindung und der spezifischen Offenbarung einer beispielhaften, unter die allgemeine Offenbarung fallenden Ausführungsform gewöhnlich davon ausgehe, dass alle weiteren unter die allgemeine Offenbarung fallenden Ausführungsformen, auch wenn sie nicht eigens erwähnt würden, ebenfalls zur Erfindung gehörten. Die nicht als Beispiel angeführten bzw. nicht bevorzugten Ausführungsformen würden somit als logische Ergänzung der explizit erwähnten Ausführungsformen implizit offenbart. Dieser Ansatz der "logischen Ergänzung" sei der korrekte Ansatz. Logischerweise würden ja durch die Ausgrenzung einer kleinen Gruppe (Y) aus einer größeren Gruppe (X) zwangsläufig zwei Gruppen entstehen, nämlich die kleine Gruppe (Y) und die verbleibende Gruppe, die sich aus der größeren Gruppe abzüglich der kleineren Gruppe ergebe (X - Y). Eine Offenbarung, die die Untergruppe (Y) aus der größeren Gruppe (X) ausgrenze, beschreibe also implizit die verbleibende Gruppe (X - Y). Ein auf (X - Y) gerichteter Anspruch sei daher vollständig durch die Offenbarung des aus (X) ausgegrenzten (Y) gestützt.

Die Beschwerdekammern akzeptierten in der Regel, dass ein bestimmter Gegenstand durch eine positive oder eine negative Formulierung definiert werden könne, die sich komplementär ergänzten. Dazu werde auf die Entscheidungen T 4/80 und T 448/93 verwiesen.

VIII. Anträge der Beschwerdeführerin

In der mündlichen Verhandlung vor der Großen Beschwerdekammer beantragte die Beschwerdeführerin, dass die Vorlagefrage mit "Nein" beantwortet werde, sofern der im Anspruch verbleibende Gegenstand klar und eindeutig offenbart sei.

IX. Äußerungen des Präsidenten des EPA

Auf der Grundlage der ständigen Rechtsprechung nach der Entscheidung T 4/80 sei in der erstinstanzlichen Praxis akzeptiert worden, dass ein bestimmter Gegenstand, der ursprünglich als mögliche Ausführungsform der Erfindung offenbart worden sei, durch die Aufnahme eines Disclaimers in den Anspruch aus dem Schutzbereich ausgeklammert werden könne, sofern sich der im Anspruch verbleibende Gegenstand durch positive Merkmale nicht klarer und knapper definieren lasse oder dadurch der Schutzumfang des Anspruchs unverhältnismäßig eingeschränkt würde. Diese Praxis habe sich nach Ergehen der Entscheidung G 1/03 nicht geändert. Ausgehend von der Formulierung der Vorlagefrage in der Sache G 1/03, aber insbesondere auch vom Wortlaut der Antworten der Großen Beschwerdekammer, sei angenommen worden, dass diese sich nur mit dem Fall befasst habe, in dem weder der Disclaimer noch der dadurch ausgeschlossene Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung offenbart werde. Nachdem jedoch einige Entscheidungen zu dem Schluss gekommen seien, dass Disclaimer auf der Grundlage von Ausführungsformen, die in der ursprünglich eingereichten Fassung der Anmeldung als Teil der Erfindung offenbart wurden, als nicht offenbarte Disclaimer anzusehen seien, für die die in G 1/03 festgelegten Kriterien gälten, sei die Praxis der ersten Instanz an die neue Rechtsprechung angepasst worden. Diese Praxis sei im Lichte der Entscheidung T 1107/06 nicht erneut geändert worden. Die derzeitige Praxis sei aus den im April 2010 veröffentlichten Richtlinien ersichtlich.

Wie in T 1107/06 unter Nummer 45 der Entscheidungsgründe ausgeführt worden sei, komme es nach Artikel 123 (2) EPÜ nicht darauf an, ob der Fachmann aus der ursprünglichen Offenbarung schließen könne, dass der Anmelder den auszuschließenden Gegenstand aus dem Schutzumfang habe ausklammern wollen. Vielmehr gelte es zu ermitteln, ob der im Anspruch verbleibende Gegenstand - explizit oder implizit - klar und eindeutig offenbart werde.

Wenn es zugleich eine allgemeine Offenbarung der Erfindung und eine spezifische Offenbarung einer beispielhaften oder bevorzugten Ausführungsform gebe, die unter die allgemeine Offenbarung falle, so gehe der Fachmann gewöhnlich davon aus, dass alle weiteren unter die allgemeine Offenbarung fallenden Ausführungsformen, auch wenn sie nicht eigens erwähnt würden, ebenfalls zur Erfindung gehörten. Die nicht als Beispiel angeführten bzw. nicht bevorzugten Ausführungsformen würden somit als logische Ergänzung der beispielhaften bzw. bevorzugten Ausführungsformen implizit offenbart.

Folglich verstoße ein Disclaimer, der einen in der ursprünglichen Fassung der Anmeldung als Ausführungsform der Erfindung offenbarten Gegenstand aus dem Schutzumfang ausschließe, nicht zwangsläufig gegen Artikel 123 (2) EPÜ. Wenn der im Anspruch verbleibende Gegenstand nicht direkt und eindeutig aus der Anmeldung in der ursprünglich eingereichten Fassung herleitbar sei, seien die in G 1/03 festgelegten Kriterien für die Zulässigkeit eines Disclaimers anzuwenden.

Die Zulässigkeit der Änderung müsse in jedem Einzelfall gesondert beurteilt werden.

Eine solche Sichtweise würde und sollte im Einklang mit der Ermittlung des Offenbarungsgehalts und der daraus herleitbaren Rechte nach Maßgabe der anderen Bestimmungen, die auf der Offenbarung eines Dokuments aufbauten, stehen.

Für die Neuheit würde dies bedeuten, dass eine Anmeldung, die zugleich eine allgemeine Offenbarung der Erfindung und eine spezifische Offenbarung einer beispielhaften oder bevorzugten, unter die allgemeine Offenbarung fallenden Ausführungsform enthalte, neuheitsschädlich für eine spätere, den Disclaimer enthaltende Anmeldung sein könne.

Betrachte man die Offenbarung als Grundlage für das Prioritätsrecht, wie in G 2/98 ausgeführt und in G 1/03 bestätigt, so bedeute dies, dass ein nicht gegen Artikel 123 (2) EPÜ verstoßender Disclaimer, der während des europäischen Erteilungsverfahrens zugelassen werde, die Identität der Erfindung im Hinblick auf Artikel 87 (1) EPÜ nicht ändere. Ebenso sollte die Aufnahme eines Disclaimers auch bei der Abfassung und Einreichung einer Teilanmeldung zulässig sein, wenn in der ursprünglich eingereichten Fassung der früheren Anmeldung der Disclaimer nicht enthalten sei, sein Gegenstand aber als Ausführungsform der Erfindung offenbart werde.

Das Ausklammern offenbarter Gegenstände könne auch relevant werden, um Doppelpatentierungen zu vermeiden, wenn Überlappungen bestünden zwischen den Ansprüchen zweier europäischer Patentanmeldungen, z. B. Stamm- und Teilanmeldungen oder Prioritäts- und Folgeanmeldungen, bzw. zwischen den Ansprüchen eines Patents auf eine europäische Patentanmeldung und denen eines Patents auf eine frühere Anmeldung in einem benannten Staat, wenn deren Priorität in der europäischen Patentanmeldung beansprucht werde und Doppelpatentierung in dem benannten Staat verboten sei. Ein Disclaimer solle außerdem zulässig sein, wenn ein Dritter eine neue Anmeldung nach Artikel 61 (1) b) EPÜ einreiche, die auf den Teil des ursprünglichen Gegenstands beschränkt sei, für den ihm der Anspruch zugesprochen worden sei. Ein weiterer Grund für einen Disclaimer könne sein, dass der Gegenstand aus nichttechnischen Gründen vom Patentschutz ausgenommen sei.

Auf jeden Fall bedürfe es klarer Vorgaben zu den Erfordernissen für die Zulässigkeit von Disclaimern - gegebenenfalls einschließlich geeigneter Übergangsbestimmungen für anhängige Anmeldungen und Patente.

X. Stellungnahmen Dritter ("Amicus-curiae-Schriftsätze")

Amicus-curiae-Schriftsätze eingereicht haben Astra Zeneca AB, das Chartered Institute of Patent Attorneys (CIPA) und mehrere zugelassene Vertreter. Im Wesentlichen wurde Folgendes vorgebracht:

- Die Vorlagefrage sei unklar, und die Antwort hänge von den Umständen des jeweiligen Einzelfalls ab. Das Ausklammern einer offenbarten Ausführungsform gefährde nicht die Rechtssicherheit Dritter und verbessere nicht die Position der Anmelderin.

- Der Anmelder könne ein berechtigtes Interesse daran haben, eine beanspruchte allgemeine Erfindung und eine spezifische Ausführungsform davon in verwandten Anmeldungen weiterzuverfolgen, entweder, um rasch Schutz für die spezifische Ausführungsform zu erlangen oder zu Finanzierungs- oder Lizenzierungszwecken.

- Die jetzige Vorlagefrage sei in G 1/03 nicht entschieden worden.

- Bei der Beurteilung des Disclaimers müsse geprüft werden, ob durch den spezifischen Disclaimer neue Gegenstände offenbart würden.

- Aus Gründen der Logik werde bei der Offenbarung eines kleinen Bereichs B (unabhängig davon, ob er ein vorteilhaftes Merkmal aufweise oder nicht) innerhalb eines allgemeinen Bereichs A unweigerlich und zwingend der Bereich A minus B offenbart. Was die technische Lehre angehe, beinhalte das Ausklammern von B keine eigene technische Lehre. Lediglich der Schutzumfang des Anspruchs werde dadurch beschränkt.

- A priori könne nach Artikel 123 (2) EPÜ ein Disclaimer zu jedem Zweck aufgenommen werden, d. h. die ausgeklammerte Ausführungsform könne durchaus patentierbar sein.

- Die Situation des Stands der Technik sei für die Beurteilung des Disclaimers nach Artikel 123 (2) EPÜ nicht relevant. Anderenfalls könnte die Beurteilung des Disclaimers anfänglich so ausfallen, dass er die Erfordernisse des Artikels 123 (2) EPÜ erfülle und später so, dass er gegen Artikel 123 (2) EPÜ verstoße, weil neuer Stand der Technik gefunden werde.

- Der Anmelder solle durch die Offenbarung einer ausgeklammerten Ausführungsform nicht schlechtergestellt werden, als wenn er eine ausgeklammerte Ausführungsform nicht offenbart hätte. Könne der relevante Stand der Technik nicht als zufällige Vorwegnahme der ausgeklammerten Ausführungsform angesehen werden, so müsse der Anmelder ggf. nachweisen, dass die im Schutzumfang des Anspruchs verbleibenden Ausführungsformen im Vergleich zu der ausgeklammerten Ausführungsform patentierbar seien. Insoweit könne genau die gleiche Situation entstehen wie in Fällen, in denen der Anspruch durch eine andere Form der Änderung beschränkt werde.

Entscheidungsgründe

1. Zulässigkeit der Vorlage

In G 1/07 (ABl. EPA 2011, 134, Nr. 4.2.3 der Entscheidungsgründe) hat die Große Beschwerdekammer darauf hingewiesen, dass ihr bewusst sei, dass in der Rechtsprechung im Anschluss an die Entscheidungen G 1/03 und G 2/03 (ABl. EPA 2004, 413 und 448) unterschiedliche Auffassungen darüber vertreten worden seien, ob diese Entscheidungen die Ausklammerung von Ausführungsformen beträfen, die in der eingereichten Fassung der Anmeldung als Teil der Erfindung offenbart seien, oder ob in diesem Fall die frühere Rechtsprechung in Anlehnung an die Entscheidung T 4/80 (ABl. EPA 1982, 149) weiterhin zur Anwendung komme. Die Große Beschwerdekammer verwies auf die Entscheidung T 1107/06 vom 3. Dezember 2008, Nummern 31 ff. der Entscheidungsgründe, und die darin angeführten Entscheidungen.

Trotz des etwas breit gefassten Wortlauts der Vorlagefrage, in der allgemein gefragt wird, ob das Ausklammern einer Ausführungsform, die in der ursprünglich eingereichten Fassung der Anmeldung als Ausführungsform der Erfindung offenbart war, gegen Artikel 123 (2) EPÜ verstößt, ist den Entscheidungsgründen Nummer 15 und 16 der Vorlageentscheidung zu entnehmen, dass die Vorlage hauptsächlich, wenn nicht gar ausschließlich zu dem Zweck erfolgte, die in den Entscheidungen T 1107/06 und G 1/07 dargestellten unterschiedlichen Auffassungen zu klären.

Darüberhinaus divergieren die Ansichten in der Rechtsprechung der Beschwerdekammern nicht nur in der Frage, was die Große Beschwerdekammer in der Entscheidung G 1/03 eigentlich entschieden hat, sondern auch darin, welches hier die richtige Lösung wäre. Sollten die in der Entscheidung G 1/03 festgelegten Kriterien angewandt werden, oder sollte, wie in T 1107/06 befunden wurde, das ausschlaggebende Kriterium sein, ob der nach Aufnahme des Disclaimers im Anspruch verbleibende Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung offenbart wurde?

Frage ist unbestreitbar auch eine Rechtsfrage von grundsätzlicher Bedeutung im Sinne des Artikels 112 (1) EPÜ, und weil die Erfüllung der Erfordernisse des Artikels 123 (2) EPÜ normalerweise vor der materiellrechtlichen Prüfung geprüft wird, ist die Vorlage zulässig (s. G 1/03, Nr. 1.2 der Entscheidungsgründe).

2. Auslegung der Vorlagefrage

2.1 Verstößt der Disclaimer gegen Artikel 123 (2) EPÜ?

Die vorlegende Kammer hat gefragt, ob ein Disclaimer gegen Artikel 123 (2) EPÜ verstößt, wenn sein Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung als Ausführungsform der Erfindung offenbart war. Weil es in Artikel 123 (2) EPÜ jedoch um Änderungen geht, und weil der Disclaimer als solcher einen nicht beanspruchten Gegenstand definiert, wird die Frage so ausgelegt, dass sie darauf gerichtet ist, ob die Änderung eines Anspruchs durch die Aufnahme eines Disclaimers gegen Artikel 123 (2) EPÜ verstößt, wenn der Gegenstand des Disclaimers in der ursprünglich eingereichten Fassung der Anmeldung als Ausführungsform der Erfindung offenbart war.

2.2 Der Begriff "Disclaimer"

Die Große Beschwerdekammer hat den Begriff "Disclaimer" in G 1/03 (Nr. 2 der Entscheidungsgründe) definiert und festgehalten, dass in Übereinstimmung mit ständiger Praxis der Begriff "Disclaimer" in ihrer Entscheidung im Sinne einer Änderung eines Anspruchs verwendet wird, die in der Aufnahme eines "negativen" technischen Merkmals in den Anspruch resultiert, womit bestimmte Ausführungsformen oder Bereiche eines allgemeinen Merkmals ausgeschlossen werden. Auf diesem Verständnis des Begriffs "Disclaimer" beruht auch die vorliegende Entscheidung.

2.3 Der Begriff "Ausführungsform"

Die vorlegende Kammer hat die Frage, ob gegen Artikel 123 (2) EPÜ verstoßen wird, auf der Grundlage formuliert, dass der ausgeschlossene Gegenstand eine "Ausführungsform" der Erfindung ist. Der Begriff "Ausführungsform" wird gemeinhin für eine spezifische Kombination von Merkmalen oder eine spezifische Art der Ausführung einer Erfindung verwendet und steht einer abstrakteren Definition von Merkmalen gegenüber, die sich auf mehr als eine Art ausführen lassen.

Disclaimer schließen jedoch nicht generell nur eine einzige spezifische Ausführungsform vom Schutz aus, sondern sind oft wesentlich weiter gefasst. Die Disclaimer schließen dann - zumindest potenziell - mehrere Ausführungsformen, eine ganze (Unter-)Gruppe von Ausführungsformen oder einen ganzen, wenn auch beschränkten Bereich aus einem allgemeinen Anspruch aus. Die Große Beschwerdekammer stellt in diesem Zusammenhang fest, dass z. B. in Anspruch 1 des Hilfsantrags III alle katalytischen Moleküle vom Schutz ausgeschlossen sind, die eine ortsspezifische intermolekulare katalytische Spaltung des Substrats entsprechend einem definierten Abschnitt der SEQ ID NO 135 unter definierten Bedingungen aufweisen.

Das Hauptproblem der Vereinbarkeit offenbarter Disclaimer mit Artikel 123 (2) EPÜ liegt nicht in dem Fall, dass eine einzige spezifischen "Ausführungsform" einer Erfindung aus einem breiteren allgemeinen Anspruch ausgeklammert wird. Es entsteht vielmehr in den Fällen, in denen ein ganzer Bereich oder eine ganze Unterklasse ausgeklammert wird. Gerade diese Fälle haben Zweifel daran aufkommen lassen, ob der nach Aufnahme eines solchen breiten Disclaimers im Anspruch verbleibende Gegenstand noch derselbe ist wie vormals beansprucht, und so entstand der Gedanke, dass bei der Prüfung, ob die Erfordernisse des Artikels 123 (2) EPÜ erfüllt sind, die Art der im Anspruch verbleibenden Gegenstände beurteilt werden muss. Es liegt auf der Hand, dass die Frage ganz unterschiedlich ausfällt, je nachdem, ob nur eine spezifische Ausführungsform aus einem allgemein abgefassten Anspruch ausgeklammert wird oder eine ganze Untergruppe bzw. ein ganzer Bereich.

Die Große Beschwerdekammer definiert in G 1/03 unter Nummer 2.1.3 der Entscheidungsgründe den möglichen Inhalt eines Disclaimers nicht nur als Ausschließung einer Ausführungsform, sondern in einem viel breiteren Sinn. Im Rahmen einer Erklärung dafür, warum ein Disclaimer nicht gegen Artikel 123 (2) EPÜ verstößt, wenn er dazu dient, den beanspruchten Gegenstand von einer kollidierenden Anmeldung abzugrenzen, spricht die Große Beschwerdekammer sehr allgemein davon, dass die Anmeldung in der ursprünglich eingereichten Fassung "eine Erfindung mit mehreren spezifischen Ausführungsformen oder Gruppen solcher Ausführungsformen" offenbart, "von denen später ein Teil" aus dem Schutzbegehren ausgeklammert wird. Es wird nicht definiert, wie eng der auszuschließende Teil gefasst sein muss, um Gegenstand eines Disclaimers sein zu können.

Dies erklärt die breit gefasste Formulierung der Antwort 1 in G 1/03, in der ein so enger Begriff wie "Ausführungsform" nicht vorkommt. Stattdessen wird die Vorlagefrage allgemein beantwortet, es ist von dem durch den Disclaimer ausgeschlossenen "Gegenstand" die Rede, analog zu der in Frage 1 der Vorlageentscheidung T 507/99 (ABl. EPA 2003, 225) verwendeten Wortwahl.

Deshalb kann die Verwendung des Begriffs "Ausführungsform" in der Vorlagefrage kein Grund dafür sein, diese Frage zu eng auszulegen. Die Vorlagefrage kann nur dann angemessen beantwortet werden, wenn man alle - und insbesondere die kritischen - Verwendungen von Disclaimern betrachtet, d. h. Disclaimer, die ganze (Unter-)Gruppen von Ausführungsformen oder ganze Bereiche aus dem Anspruchsgegenstand ausschließen. Nach Auffassung der Großen Beschwerdekammer ist der Begriff "Ausführungsform" in der Vorlagefrage folglich so zu verstehen, dass es um die Ausklammerung eines "Gegenstands" geht. Die Große Beschwerdekammer wird in ihrer Antwort diesen Begriff verwenden.

3. Wurde in G 1/03 über Disclaimer entschieden, die einen in der ursprünglich eingereichten Fassung der Anmeldung offenbarten Gegenstand ausklammern?

In den Entscheidungen der Technischen Beschwerdekammern, die in T 1107/06 unter Nummer 42 der Entscheidungsgründe angeführt werden, wurde der in Antwort 2 der Entscheidung G 1/03 verwendete Begriff des "in der Anmeldung in der ursprünglich eingereichten Fassung nicht offenbarten Disclaimers" so verstanden, dass die in Antwort 2 festgelegten Kriterien für alle Fälle gelten sollten, in denen der Disclaimer als solcher in der ursprünglich eingereichten Fassung der Anmeldung nicht offenbart wurde, und das würde auch die Fälle einschließen, in denen zwar nicht der Disclaimer als solcher, wohl aber sein Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung offenbart wurde.

Auslegung der Entscheidung G 1/03 ist aus den folgenden Gründen unrichtig:

3.1 Aus Frage 1 der ersten Vorlageentscheidung, T 507/99 (Leitsatz), wird ganz deutlich, dass es in dieser Vorlage nur um den Fall ging, in dem weder der Disclaimer noch der durch ihn aus dem beanspruchten Bereich ausgeschlossene Gegenstand aus der Anmeldung in der ursprünglich eingereichten Fassung herleitbar ist. In Frage 1 wird diese Bedingung ausdrücklich genannt, nachdem die vorlegende Kammer in Nummer 3 der Entscheidungsgründe festgestellt hat, dass im betreffenden Fall weder die Disclaimer als solche noch der ausgeschlossene Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung offenbart worden seien.

In der zweiten Vorlageentscheidung, T 451/99 (ABl. EPA 2003, 334, Leitsatz), wird in der ersten Vorlagefrage der Begriff eines "von der Anmeldung in der ursprünglich eingereichten Fassung nicht gestützten Disclaimers" verwendet, aber es ist klar, insbesondere in Anbetracht der Nummern 4 und 24 der Entscheidungsgründe, dass die vorlegende Kammer damit - auch - den Fall ansprach, in dem weder der Disclaimer als solcher noch der durch ihn ausgeschlossene Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung offenbart wurde.

3.2 Trotz einiger Unterschiede im Wortlaut enthalten beide Vorlageentscheidungen in den weiteren Fragen, in denen die Große Beschwerdekammer gebeten wurde, die Kriterien für die Beurteilung der Zulässigkeit eines Disclaimers festzulegen, einen Rückverweis auf die jeweils erste Frage. In beiden Entscheidungen wurden die weiteren Fragen der Großen Beschwerdekammer nur für den Fall vorgelegt, dass sie Frage 1 nicht in dem Sinne beantworten würde, dass eine Änderung eines Anspruchs durch die Aufnahme eines Disclaimers schon deshalb nach Artikel 123 (2) EPÜ unzulässig ist, weil weder der Disclaimer noch der durch ihn aus dem Schutzumfang des Anspruchs ausgeschlossene Gegenstand aus der Anmeldung in der ursprünglich eingereichten Fassung herleitbar ist (d. h. durch die Anmeldung in der ursprünglich eingereichten Fassung gestützt wird, im Wortlaut von T 451/99).

3.3 Die Große Beschwerdekammer folgt in ihren Antworten exakt der Struktur der Vorlagefragen. Zunächst wird in Antwort 1 das Grundprinzip vorgegeben. Darin heißt es ausdrücklich, dass sich die Antwort auf den Fall bezieht, in dem weder der Disclaimer noch der durch ihn aus dem beanspruchten Bereich ausgeschlossene Gegenstand aus der Anmeldung in der ursprünglich eingereichten Fassung herleitbar ist. In Antwort 2 und ihren Unterantworten werden die weiteren Vorlagefragen behandelt und die Kriterien für die Beurteilung der Zulässigkeit eines solchen Disclaimers genauer definiert.

In Anlehnung an die Struktur der Vorlagefragen ist Antwort 1 allerdings nur negativ formuliert und gibt an, mit welcher Begründung eine Änderung nicht nach Artikel 123 (2) EPÜ zurückgewiesen werden kann (nämlich nicht schon deshalb, weil weder der Disclaimer noch der durch ihn aus dem beanspruchten Bereich ausgeschlossene Gegenstand aus der Anmeldung in der ursprünglich eingereichten Fassung herleitbar ist). Somit ist klar, dass Antwort 1 die Vorlagefragen nur teilweise beantwortet, und dass es zu einer vollständigen Klärung weiterer Antworten bedarf.

In einem Fall wie diesem, in dem eine Antwort eine andere Antwort zur Klärung der gestellten Fragen ergänzt und die Fragen alle durch bestimmte Umstände definiert sind (hier: dass weder der Disclaimer noch der durch ihn ausgeschlossene Gegenstand aus der Anmeldung in der ursprünglich eingereichten Fassung herleitbar ist), kann diese weitere Antwort nicht aus dem Kontext gerissen oder isoliert betrachtet werden. Genau wie bei den weiteren Vorlagefragen (s. dazu insbesondere Entscheidung T 507/99) enthält Antwort 2 einen Rückverweis auf die Kriterien, die im Kontext der in Antwort 1 enthaltenen grundlegenden Antwort anzuwenden sind, sowie nähere Erläuterungen dazu. Im Lichte von Antwort 1 gelesen, zeigt sich, dass der in Antwort 2 verwendete Begriff des "in der Anmeldung in der ursprünglich eingereichten Fassung nicht offenbarten Disclaimers" das Bindeglied zu Antwort 1 ist. Vielleicht hätte man diese Passage der Antwort 2 so abfassen können, dass die entsprechende Formulierung aus Antwort 1 wörtlich wiederholt wird. Aus der oben beschriebenen Struktur der Antworten ? die der Struktur der Vorlagefragen entspricht ? erschließt sich jedoch eindeutig, dass die Antwort der Großen Beschwerdekammer auf die ergänzende Frage 2 den in Antwort 1 genannten Fall betrifft, d. h. den Fall, in dem weder der Disclaimer noch der durch ihn ausgeschlossene Gegenstand aus der Anmeldung in der ursprünglich eingereichten Fassung herleitbar ist. In den Entscheidungsgründen von G 1/03 wird dies später durch den Begriff "nicht offenbarter Disclaimer" (s. etwa Nr. 2.1 der Entscheidungsgründe) zum Ausdruck gebracht, und diese Wortwahl wird im vorliegenden Fall übernommen.

Die strittige Passage in Antwort 2 kann also nicht so ausgelegt werden, als habe die Große Beschwerdekammer entscheiden wollen, dass auf den in den Vorlagefragen nicht behandelten Fall, in dem der durch den Disclaimer ausgeschlossene Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung offenbart war, die in Antwort 2 festgelegten Kriterien anzuwenden sind.

3.4 Da keine gegenteiligen Hinweise vorliegen, kann davon ausgegangen werden, dass die Große Beschwerdekammer, wenn sie denn beabsichtigt hätte, der Antwort 2 eine über den Umfang der gestellten Fragen hinausgehende Bedeutung zu verleihen, dies eindeutig zu verstehen gegeben hätte. Zudem deutet im weiteren Wortlaut der Entscheidung G 1/03 nichts darauf hin, dass nach dem Dafürhalten der Großen Beschwerdekammer die in Antwort 2 festgelegten Erfordernisse für die Zulässigkeit von Disclaimern auch auf das Ausklammern von Gegenständen anwendbar sein sollten, die in der ursprünglich eingereichten Fassung der Anmeldung offenbart waren.

3.5 Nummer 2.5 der Entscheidungsgründe von G 1/03 stützt nicht die Schlussfolgerung, die die Technische Beschwerdekammer in der Entscheidung T 1050/99 vom 2. Januar 2005, Nummern 6 und 7 d) der Entscheidungsgründe, aus dieser Passage gezogen hat, nämlich, dass G 1/03 sich auch auf Disclaimer für offenbarte Gegenstände beziehe. In Nummer 2.5 der Entscheidungsgründe von G 1/03 befasst sich die Große Beschwerdekammer allgemein mit der Frage, ob in einem Anspruch enthaltene nicht funktionsfähige Ausführungsformen durch einen Disclaimer ausgeklammert werden dürfen. Nirgends wird erwähnt, dass, obwohl es in der besagten Entscheidung eigentlich um Disclaimer für in der ursprünglich eingereichten Fassung der Anmeldung nicht offenbarte Gegenstände geht, in Nummer 2.5 der Entscheidungsgründe aber der Fall erörtert wird, in dem die nicht funktionsfähigen Ausführungsformen in der ursprünglich eingereichten Fassung der Anmeldung offenbart sind. Dass es in den beiden von der Großen Beschwerdekammer in diesem Kontext angeführten Entscheidungen, T 170/87 (ABl. EPA 1989, 441, Nr. 8.4 der Entscheidungsgründe) und T 313/86 vom 12. Januar 1988 (auf die in T 170/87 verwiesen wird), um Disclaimer ging, bei denen die auszuschließenden Gegenstände nicht in der ursprünglich eingereichten Fassung der Anmeldung offenbart waren, ist ebenfalls ein Indiz dafür, dass diese Passage nicht so auszulegen ist, wie es in der Entscheidung T 1050/99 vorgeschlagen wird.

3.6 Des Weiteren ist, wie der Vertreter der Beschwerdeführerin ausgeführt hat, das in Nummer 3 der Entscheidungsgründe von G 1/03 festgelegte Erfordernis für die Formulierung eines Disclaimers, nämlich dass der Disclaimer nicht mehr ausklammern sollte, als notwendig ist, um die Neuheit wiederherzustellen, nicht auf das Ausklammern offenbarter Gegenstände anwendbar, da in diesem Fall der Wortlaut des Disclaimers mit der Offenbarung des ausgeklammerten Gegenstands in der ursprünglich eingereichten Fassung der Anmeldung übereinstimmen muss.

3.7 In Nummer 2 der Entscheidungsgründe von G 1/03 erklärt die Große Beschwerdekammer, warum sie die Formulierung "nicht offenbarter" Disclaimer verwendet und den Ausdruck "nicht gestützter" Disclaimer vermeidet, der in der Vorlageentscheidung T 451/99 für den Fall verwendet worden war, in dem weder der Disclaimer als solcher noch die ausgeklammerten Ausführungsformen in der ursprünglich eingereichten Fassung der Anmeldung offenbart waren. Wie aus den Erläuterungen der Großen Beschwerdekammer hervorgeht, wollte sie mit dem geänderten Wortlaut lediglich eine Verwechslung der Erfordernisse des Artikels 123 (2) EPÜ mit denen des Artikels 84 EPÜ vermeiden, der den Begriff "gestützt" enthält.

3.8 Bestärkt wird die Große Kammer in ihrer Schlussfolgerung auch dadurch, dass in nationalen Entscheidungen derselbe Standpunkt vertreten und die Entscheidung G 1/03 genauso ausgelegt wurde ("Napp Pharmaceutical Holdings Ltd v. Ratiopharm GmbH und Sandoz Ltd", England and Wales Court of Appeal, [2009] EWCA Civ 252, Nummer 82 ff. der Urteilsbegründung mit Verweis auf T 1139/00; "Mundipharma Pharmaceuticals B.V. v. Sandoz B.V.", Landgericht Den Haag vom 7. April 2010, Fall Nr. 340373/09-2029, Nr. 4.11 ff. der Urteilsbegründung). Besonders deutlich wird dies im oben genannten Urteil des Landgerichts Den Haag, denn das Gericht erläutert in einer sehr umfassenden und überzeugenden Begründung, die der Begründung der Großen Beschwerdekammer in der vorliegenden Entscheidung entspricht, warum es zu dem Schluss kommt, dass die Entscheidung G 1/03 sich nur auf Fälle bezieht, in denen "weder der Disclaimer noch der Gegenstand des Disclaimers (d. h. der ausgeschlossene Gegenstand) aus der Anmeldung in der ursprünglich eingereichten Fassung herleitbar ist" (a. a. O., englische Übersetzung in der Akte).

3.9 Abschließend lässt sich also nicht sagen, dass sich Antwort 2 der Entscheidung G 1/03 auf das Ausklammern eines Gegenstands bezieht, der in der ursprünglich eingereichten Fassung der Anmeldung als Teil der Erfindung offenbart war.

4. Verstößt die Änderung eines Anspruchs durch die Aufnahme eines Disclaimers, der einen in der ursprünglichen Fassung der Anmeldung offenbarten Gegenstand ausklammert, gegen Artikel 123 (2) EPÜ?

4.1 Umfang der Vorlagefrage

In Nummer 15 der Entscheidungsgründe der Vorlageentscheidung definiert die vorlegende Kammer den Zweck der Vorlage so, dass dadurch die strittige Frage geklärt werden soll, ob die in G 1/03 festgelegten Bedingungen auch auf das Ausklammern von offenbarten Gegenständen Anwendung finden oder ob es vielmehr darauf ankommen sollte, ob der nach Aufnahme des Disclaimers im Anspruch verbleibende Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung offenbart war (s. auch Nr. 1). Klar ist allerdings, dass die Große Beschwerdekammer bei der Beurteilung und Entscheidung der Vorlagefrage - die ja weiter gefasst war - keinesfalls darauf beschränkt ist, nur über diese beiden gegensätzlichen, alternativen Auslegungen der Beschwerdekammern zu entscheiden. Aufgabe der Großen Kammer ist es vielmehr ? auch wenn sie frühere Entscheidungen zu dieser Frage berücksichtigen wird ? von Amts wegen die Kriterien dafür festzulegen, wann das Ausklammern offenbarter Gegenstände als Verstoß gegen Artikel 123 (2) EPÜ anzusehen ist.

4.2 Wortlaut des Artikels 123 (2) EPÜ

Artikel 123 (2) EPÜ lautet:

"(2) Die europäische Patentanmeldung und das europäische Patent dürfen nicht in der Weise geändert werden, dass ihr Gegenstand über den Inhalt der Anmeldung in der ursprünglich eingereichten Fassung hinausgeht."

4.3 Das Grundprinzip des Artikels 123 (2) EPÜ in der Rechtsprechung der Großen Beschwerdekammer

Die Bedeutung und ausnahmslose Anwendbarkeit des Artikels 123 (2) EPÜ wurde in der Rechtsprechung der Großen Beschwerdekammer schon sehr früh, nämlich in der Stellungnahme G 3/89 und in der Entscheidung G 11/91 (ABl. EPA 1993, 117 und 125, zu Änderungen in Form von Berichtigungen) unterstrichen. Aus dieser Rechtsprechung folgt, dass jede Änderung an den die Offenbarung betreffenden Teilen einer europäischen Patentanmeldung oder eines europäischen Patents (der Beschreibung, der Patentansprüche und der Zeichnungen) dem in Artikel 123 (2) EPÜ statuierten zwingenden Erweiterungsverbot unterliegt und daher unabhängig vom Kontext der vorgenommenen Änderung nur im Rahmen dessen erfolgen darf, was der Fachmann der Gesamtheit dieser Unterlagen in ihrer ursprünglich eingereichten Fassung unter Heranziehung des allgemeinen Fachwissens ? objektiv und bezogen auf den Anmeldetag ? unmittelbar und eindeutig entnehmen kann (Nrn. 1, 1.3 und 3 der Entscheidungsgründe).

Prinzipiell bestätigt wurden diese Feststellungen in der Entscheidung G 1/93 (ABl. EPA 1994, 541, Antwort 1, Satz 1) zum Einspruchsgrund nach Artikel 100 c) EPÜ und ? auf allgemeinerer Ebene ? in G 2/98 (ABl. EPA 2001, 413), die das in Artikel 87 (1) EPÜ genannte Erfordernis "derselben Erfindung" betraf. In dieser Entscheidung zog die Große Beschwerdekammer auch einen Offenbarungstest heran, um zu ermitteln, ob die spätere Anmeldung dieselbe Erfindung zum Gegenstand hatte wie die prioritätsbegründende Anmeldung, und verwies dabei ausdrücklich auf den nach Artikel 123 (2) EPÜ angewandten Offenbarungstest (Antwort, s. auch Nrn. 1 und 9 der Begründung).

In der Entscheidung G 1/93, die die Beziehung zwischen den Absätzen 2 und 3 des Artikels 123 EPÜ betraf, wenn der Patentinhaber in einer sogenannten "unentrinnbaren Falle" sitzt, hatte die Große Beschwerdekammer in Bezug auf das Argument, es bestehe eine Wechselbeziehung zwischen den Absätzen 2 und 3 des Artikels 123 EPÜ, wobei je nach Lage des Einzelfalls der eine als vorrangig und der andere als nachrangig anzuwenden sei, Folgendes festgestellt:

"Wie in der Stellungnahme der Großen Beschwerdekammer in der Sache G 3/89 (ABl. EPA 1993, 117) erläutert, steht diese Auslegung nicht im Einklang mit dem verbindlichen Charakter des Artikels 123 (2) EPÜ." (Nr. 13 der Entscheidungsgründe)

Die Große Beschwerdekammer gelangte in der Entscheidung G 1/93 allerdings zu dem Schluss, dass man, wenn ein nicht offenbartes beschränkendes Merkmal - ohne einen technischen Beitrag zum Gegenstand der beanspruchten Erfindung zu leisten - lediglich den Schutz für einen Teil des Gegenstands der beanspruchten Erfindung gemäß der Anmeldung in der ursprünglich eingereichten Fassung ausschließt, vernünftigerweise nicht unterstellen kann, dass seine Hinzufügung dem Anmelder zu einem ungerechtfertigten Vorteil verhilft, weshalb es bei richtiger Auslegung des Artikels 123 (2) EPÜ nicht als Gegenstand zu betrachten ist, der im Sinne dieser Bestimmung über den Inhalt der Anmeldung in der ursprünglich eingereichten Fassung hinausgeht (Nr. 16 der Entscheidungsgründe).

Aus dem Kontext dieser Feststellungen ist jedoch ersichtlich, dass die Große Beschwerdekammer mit der Einführung des Kriteriums des "technischen Beitrags" nicht etwa die Definition ändern wollte, wann eine Änderung nach Artikel 123 (2) EPÜ generell zulässig ist, sondern nur nach einer Möglichkeit gesucht hat, die potenziell fatale Konsequenz zu vermeiden, dass der Patentinhaber zwischen den Erfordernissen von Artikel 123 (2) und (3) EPÜ in einer unentrinnbaren Falle sitzt (s. Nr. 13 der Entscheidungsgründe).

Auch wenn der in dieser Entscheidung zum Ausdruck gebrachte allgemeine Grundsatz ? nämlich dass Artikel 123 (2) EPÜ verhindern soll, dass der Anmelder durch eine Änderung einen ungerechtfertigen Vorteil erhält ? oft angeführt wird und in späteren Entscheidungen der Großen Beschwerdekammer als Sinn und Zweck von Artikel 123 (2) EPÜ herausgestellt wurde, ist in diesen späteren Entscheidungen doch deutlich gemacht worden, dass es in G 1/93 um die kollidierenden Erfordernisse von Artikel 123 (2) und (3) EPÜ ging und sie somit "einen völlig anderen rechtlichen Sachverhalt" betrifft. So drückte es die Große Beschwerdekammer in der Stellungnahme G 2/98 in Nummer 10 der Gründe aus, in der der Offenbarungstest der G 3/89 auf den Begriff derselben Erfindung angewandt wurde.

In G 1/03, Nummer 2, vorletzter Absatz der Entscheidungsgründe wird ebenfalls davon ausgegangen, dass die Entscheidung G 1/93 die Beziehung zwischen den Absätzen 2 und 3 des Artikels 123 EPÜ betrifft. Nach einer Darlegung des in der Entscheidung T 323/97 festgestellten Widerspruchs zwischen G 1/93 und G 2/98 im Hinblick auf die Frage, ob es relevant ist, dass ein hinzugefügtes Merkmal einen technischen Beitrag zu dem beanspruchten Gegenstand leistet, verzichtet die Große Beschwerdekammer darauf, Stellung zu beziehen, und schließt mit den Worten: "Die in T 323/97 verneinte Frage wird im Folgenden mit Bezug auf die verschiedenen im vorliegenden Verfahren denkbaren Situationen untersucht" (Nr. 2 der Entscheidungsgründe, letzter Absatz).

Somit ist festzuhalten, dass weder in der Entscheidung G 1/93 noch in der Entscheidung G 1/03 beabsichtigt wurde, die allgemeine Definition der Erfordernisse des Artikels 123 (2) EPÜ zu ändern, die in der Stellungnahme G 3/89 und in der Entscheidung G 11/91 aufgestellt wurde und mittlerweile zum allgemein akzeptierten Maßstab oder auch "Goldstandard" für die Beurteilung geworden ist, ob eine Änderung mit Artikel 123 (2) EPÜ in Einklang steht. Daher gilt diese Definition auch für solche Fälle, wie sie dieser Vorlage zugrunde liegen.

4.4 Ist aus G 1/03 abzuleiten, dass die Aufnahme eines Disclaimers, der offenbarte Gegenstände ausklammert, den im Anspruch verbleibenden Gegenstand a priori nicht verändern kann und daher immer zulässig ist?

Bestimmte Passagen in dieser Entscheidung könnten so interpretiert werden und wurden auch so interpretiert, dass die Große Beschwerdekammer darin den Standpunkt zum Ausdruck bringt, dass die Aufnahme eines Disclaimers a priori nicht die in der Anmeldung in der ursprünglich eingereichten Fassung enthaltene technische Information und daher auch nicht den im Anspruch verbleibenden Gegenstand verändern kann.

4.4.1 Die Entscheidung

In Nummer 2.1.3 der Entscheidungsgründe stellt die Große Beschwerdekammer nach einer umfassenden Erläuterung der Rechtsgeschichte des Artikels 54 (3) EPÜ ("whole contents approach" vs. "prior claim approach") mit Blick auf die Frage, ob die in der Anmeldung enthaltenen technischen Informationen durch die Aufnahme eines Disclaimers verändert werden können, Folgendes fest:

"Für die Auslegung des Artikels 123 (2) EPÜ lässt sich aus dem Vorstehenden (Nr. 2.1.1) folgern, dass ein eine kollidierende Anmeldung ausschließender Disclaimer lediglich dazu dient, dem Umstand Rechnung zu tragen, dass das Recht auf das Patent für verschiedene Aspekte eines erfinderischen Gegenstands verschiedenen Anmeldern zusteht, und nicht dazu, die gegebene technische Lehre zu ändern. Der Disclaimer spaltet die Gesamterfindung in zwei Teile: ...

Ein solcher Disclaimer, der einen Gegenstand lediglich aus rechtlichen Gründen ausschließt, ist erforderlich, um Artikel 54 (3) EPÜ umzusetzen, und hat keine Auswirkung auf die in der Anmeldung enthaltenen technischen Informationen. ... Die Anmeldung in der ursprünglich eingereichten Fassung offenbart eine Erfindung mit mehreren spezifischen Ausführungsformen oder Gruppen solcher Ausführungsformen, von denen später ein Teil aus dem Schutzbegehren ausgeklammert, d. h. nicht mehr beansprucht wird. Der verbleibende Gegenstand wird durch den Disclaimer nicht verändert. ..."

In Nummer 2.2.1 der Entscheidungsgründe stellt die Große Beschwerdekammer dann fest:

"Das Konzept der zufälligen Vorwegnahme ist - ausgehend von der Prämisse, dass es nur um die Neuheit geht - mit der bereits erörterten Sachlage bei kollidierenden Anmeldungen vergleichbar. Auch im Falle einer zufälligen Vorwegnahme dient der Ausschluss des unerheblichen Stands der Technik nicht dazu, zum erfinderischen Charakter der gegebenen technischen Lehre beizutragen."

4.4.2 Bedeutung dieser Rechtsprechung

Um die vorstehend zitierten Ausführungen richtig beurteilen zu können, muss man ihren Kontext wie auch einige weitere Feststellungen in dieser Entscheidung berücksichtigen.

Der Kontext besteht zunächst einmal darin, dass in einer vorhergehenden Passage, d. h. in Nummer 2 Absatz 2 der Entscheidungsgründe, die Große Beschwerdekammer das Argument bereits geprüft und widerlegt hat, dass ein Disclaimer eine rein freiwillige Beschränkung sei, durch die der Anmelder auf einen Teil des beanspruchten Gegenstands verzichte, dass ein Disclaimer somit per se kein technisches Merkmal des Anspruchs sei, nicht gegen Artikel 123 (2) EPÜ verstoßen könne und stets zugelassen werden sollte. Die Große Beschwerdekammer hielt dagegen, dass jeder Änderung eines Anspruchs eine technische Bedeutung zu unterstellen ist, sonst wäre sie in dem Anspruch nutzlos. Damit hat sie sich ganz offensichtlich nicht der Auffassung angeschlossen, dass das Ausklammern von Gegenständen per se die in der Anmeldung enthaltene technische Information nicht verändern und daher per se nicht gegen Artikel 123 (2) EPÜ verstoßen könne.

So ist denn das in Nummer 2.1.3 der Entscheidungsgründe genannte Beispiel einer Anmeldung, die in der ursprünglich eingereichten Fassung eine Erfindung mit mehreren spezifischen Ausführungsformen oder Gruppen solcher Ausführungsformen offenbart, von denen später ein Teil aus dem Schutzbegehren ausgeklammert wird, als ein typisches Beispiel für den Fall zu verstehen, in dem der Disclaimer in der Regel die technische Lehre des im Anspruch verbleibenden Gegenstands nicht verändert und keine Informationen hinzufügt. Es kann nicht so interpretiert werden, als hätte die Große Beschwerdekammer damit den Grundsatz aufstellen wollen, dass die Änderung eines Anspruchs durch die Aufnahme eines Disclaimers, der eine offenbarte Ausführungsform ausklammert, den im Anspruch verbleibenden Gegenstand per se nicht verändern und daher nie gegen Artikel 123 (2) EPÜ verstoßen kann.

Dies wird durch die Feststellungen der Großen Beschwerdekammer in den Nummern 2.6.2 und 2.6.5 der Entscheidungsgründe untermauert. In Nummer 2.6.2 spricht die Große Beschwerdekammer von dem "Grundsatz, wonach eine nicht offenbarte Beschränkung, um zulässig zu sein, ein reiner Disclaimer im oben beschriebenen Sinn sein muss". Was damit gemeint ist, wird anschließend in Nummer 2.6.5 der Entscheidungsgründe näher erläutert, wo es heißt:

"2.6.5 Aus dem Vorstehenden ergibt sich, dass ein Disclaimer nur zu dem jeweils beabsichtigten Zweck und zu nichts anderem eingesetzt werden darf. Bei kollidierenden Anmeldungen besteht sein Zweck darin, die Neuheit gegenüber einer früheren Anmeldung im Sinne von Artikel 54 (3) EPÜ herzustellen. Bei einem Stand der Technik nach Artikel 54 (2) EPÜ dient er dem Zweck, die Neuheit gegenüber einer zufälligen Vorwegnahme in dem in dieser Entscheidung definierten Sinn herzustellen. Ein Disclaimer, der einen nicht patentfähigen Gegenstand ausschließt, darf nur dazu dienen, das konkrete rechtliche Hindernis zu beseitigen. Hat ein Disclaimer Wirkungen, die über den hier genannten Zweck hinausgehen, so ist oder wird er unzulässig."

Es stimmt zwar, dass diese Feststellungen, insbesondere der zuletzt zitierte Satz, nur in den Entscheidungsgründen enthalten sind und nicht direkt Eingang in Antwort 2 der Entscheidungsformel gefunden haben, wo die Kriterien für die Beurteilung der Zulässigkeit eines nicht offenbarten Disclaimers festgelegt werden. Dies bedeutet aber nicht, dass die oben zitierten Feststellungen unbedacht getroffen wurden und als nicht so gemeint zu nehmen sind, wie sie getroffen wurden. Bei den Fragen, die der Großen Beschwerdekammer in den Fällen G 1/03 und G 2/03 zur Beantwortung vorgelegt wurden, ging es ja im Wesentlichen darum, ob, und wenn ja, unter welchen Umständen nicht offenbarte Disclaimer trotz fehlender Grundlage in der ursprünglich eingereichten Fassung der Anmeldung überhaupt grundsätzlich als zulässig angesehen werden können. Diese Frage und nichts anderes hat die Große Beschwerdekammer in Antwort 2 beantwortet. Der von ihr in der ersten Zeile von Antwort 2 gewählte Wortlaut "ein Disclaimer kann zulässig sein" deutet darauf hin, dass die Große Beschwerdekammer mit den in Antwort 2 festgelegten Kriterien nicht erschöpfend definieren wollte, wann ein Disclaimer gegen Artikel 123 (2) EPÜ verstößt und wann nicht.

In diesem Sinne wurde die Lehre der Entscheidung G 1/03 auch zuerst in der Entscheidung T 1139/00 vom 10. Februar 2005 und danach in den oben genannten nationalen Entscheidungen ausgelegt, auch in Bezug auf Disclaimer für offenbarte Gegenstände.

In der Entscheidung T 1139/00 stellt die Kammer zunächst in Nummer 2.5 der Entscheidungsgründe fest, dass der durch den Disclaimer ausgeschlossene Gegenstand durch die ursprünglich eingereichte Fassung der Anmeldung gestützt wird; dann begründet sie in den (mit "Article 123 (2) EPC" überschriebenen) Nummern 3 und  4 der Entscheidungsgründe ausführlich, warum die Aufnahme des Disclaimers nur den Schutzumfang einschränkt, ohne einen technischen Beitrag zu der beanspruchten Erfindung zu leisten (Nr. 3.1 der Entscheidungsgründe), und warum dadurch nur eine beschränktere Gruppe verbleibt (Nr. 4.1 der Entscheidungsgründe, am Ende). Die Kammer war also nicht der Auffassung, dass die Erfordernisse des Artikels 123 (2) EPÜ automatisch erfüllt sind, wenn die Beschränkung durch einen Disclaimer für einen offenbarten Gegenstand erfolgt.

In dem oben genannten Urteil des England and Wales Court of Appeal stellt Jacob LJ in Nummer 82 der Urteilsbegründung unter Bezugnahme auf die Entscheidung T 1139/00 fest:

"In G 1/03 wird keine weitere oder umfassendere Regel festgelegt als die Grundregel, wonach ein nicht offenbarter Disclaimer als keine Gegenstände hinzufügend zulässig ist, sofern er ein "reiner Disclaimer" ist."

In Nummer 83 der Urteilsbegründung fährt er, wieder unter Bezugnahme auf die Entscheidung T 1139/00, fort: "Diese Technische Beschwerdekammer war also der Auffassung, dass G 1/03 auf Disclaimer beschränkt sei, die die Neuheit wiederherstellen oder nicht patentierbare Gegenstände ausschließen. Sie stellte dann ? unseres Erachtens zu Recht ? die eigentliche Frage, nämlich: "Wurden Gegenstände hinzugefügt?"

In Nummer 85 der Urteilsbegründung heißt es schließlich mit Bezug auf das angefochtene Urteil: "Floyd J hatte völlig Recht, als er sagte: [122] Bei der Prüfung, ob Gegenstände hinzugefügt wurden, bleibt es bei dem im Übereinkommen und im Gesetz festgelegten Test …".

Im Urteil des Landgerichts Den Haag befürwortet auch dieses Gericht ausdrücklich die in der Entscheidung T 1139/00 getroffene Feststellung, dass die Zulässigkeit eines "offenbarten" Disclaimers anhand von Artikel 123 (2) EPÜ zu prüfen sei und es vorstellbar sei, dass sich die technische Lehre des Patents durch den Ausschluss eines Gegenstands verändere, der in ihm ursprünglich durch positive Angaben enthalten gewesen sei (Nrn. 4.14 und 4.15 der Urteilsbegründung).

4.5 Anzuwendende Kriterien

4.5.1 Offenbarungstest

Es ist folglich im Einklang mit der oben genannten Rechtsprechung der Großen Beschwerdekammer und den nationalen Entscheidungen, dass der Grundsatz, dass jede Änderung einer Anmeldung oder eines Patents und insbesondere eines Anspruchs die Erfordernisse des Artikels 123 (2) EPÜ erfüllen muss, auch für Änderungen gilt, die den Anspruch durch Ausklammern offenbarter Gegenstände einschränken.

Wie bei jeder anderen Änderung ist also bei der Änderung eines Anspruchs, durch die ein Gegenstand ausgeklammert wird, der in der ursprünglich eingereichten Fassung der Anmeldung als Teil der Erfindung offenbart war, zu prüfen, ob sie dazu führt, dass der Fachmann neue technische Informationen erhält. Das Ausklammern eines in der Anmeldung offenbarten Gegenstands kann folglich ein Verstoß gegen Artikel 123 (2) EPÜ sein, wenn es dazu führt, dass der Fachmann technische Informationen erhält, die er der ursprünglich eingereichten Fassung der Anmeldung unter Heranziehung des allgemeinen Fachwissens nicht unmittelbar und eindeutig entnehmen würde.

4.5.2 Wie ist die ursprüngliche Offenbarung des beanspruchten Gegenstands zu bestimmen, wenn ein Anspruch durch die Aufnahme eines Disclaimers geändert wurde?

Die kritische Frage ist, wie die ursprüngliche Offenbarung des beanspruchten Gegenstands zu bestimmen ist, wenn ein Disclaimer in den Anspruch aufgenommen wird, der einen offenbarten Gegenstand ausklammert. Wird ein positives Merkmal, welches einen Gegenstand definiert, der tatsächlich beansprucht wird, in einen Anspruch aufgenommen, so kann geprüft werden, ob der Gegenstand dieses Merkmals in der ursprünglich eingereichten Fassung der Anmeldung offenbart wurde. Was die neue, nach der Aufnahme dieses Merkmals beanspruchte Merkmalskombination betrifft, kann geprüft werden, ob diese Kombination in der ursprünglich eingereichten Fassung der Anmeldung offenbart wurde.

Im Gegensatz dazu macht der im Disclaimer definierte technische Gegenstand den ausgeklammerten Gegenstand als solchen nicht zum Bestandteil der Definition der beanspruchten Erfindung. Ein Disclaimer als solcher definiert mitnichten ein Merkmal der beanspruchten Erfindung. Es verhält sich genau umgekehrt. Er definiert etwas, das nicht beansprucht wird. Wenn es also zu bestimmen gilt, ob der Anspruch nach der Aufnahme des Disclaimers gegen Artikel 123 (2) EPÜ verstößt oder die Erfordernisse dieses Artikels erfüllt, so kann dies nicht allein durch die Feststellung entschieden werden, dass der beanspruchte Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung offenbart war.

Ob der Fachmann neue Informationen erhält, hängt davon ab, wie er den geänderten Anspruch, d. h. den im geänderten Anspruch verbleibenden Gegenstand verstehen würde und ob er unter Heranziehung des allgemeinen Fachwissens diesen Gegenstand als zumindest implizit in der Anmeldung offenbart ansehen würde.

Diese Aussage entspricht der Definition in Artikel 123 (2) EPÜ. Übertragen auf die hier erörterte Frage der Änderung eines Anspruchs würde Artikel 123 (2) EPÜ lauten:

"Der Anspruch darf nicht in der Weise geändert werden, dass sein Gegenstand über den Inhalt der Anmeldung in der ursprünglich eingereichten Fassung hinausgeht."

Damit folgt schon aus dem Wortlaut des Artikels 123 (2) EPÜ, dass der Bezugspunkt für die Beurteilung, ob ein geänderter Anspruch die Erfordernisse des Artikels 123 (2) EPÜ erfüllt, der Gegenstand ist, den der Anspruch nach der Änderung enthält, d. h. der nach der Änderung im Anspruch verbleibende Gegenstand.

4.5.3 Gesetze der Logik

Ob dieser Gegenstand ursprünglich offenbart wurde oder nicht, kann nicht anhand sogenannter Gesetze der Logik entschieden werden, wonach bei einer Anmeldung, die eine allgemeine Lehre und spezifische Ausführungsformen, Gruppen solcher Ausführungsformen oder Bereiche offenbart, implizit auch alle anderen potenziellen Ausführungsformen, Gruppen solcher Ausführungsformen oder Bereiche, die unter die allgemeine technische Lehre fallen (aber nicht als solche in der ursprünglich eingereichten Fassung der Anmeldung offenbart sind), zwangsläufig mit offenbart werden. In diesem Zusammenhang wurde auch vorgebracht, dass bei der Offenbarung einer Ausführungsform oder eines kleineren Bereichs (B) innerhalb eines größeren Bereichs (A), der ebenfalls offenbart wird, damit logischerweise und zwangsläufig der Gegenstand des breiteren Bereichs abzüglich der Ausführungsform (A minus B) offenbart wird, und dass ein Anspruch, der einen solchen Disclaimer enthält, aus diesem Grund keinen Gegenstand enthält, der gegen Artikel 123 (2) EPÜ verstößt.

Selbst wenn gesagt werden kann, dass es für den verbleibenden Gegenstand normalerweise kein Problem mit der ursprünglichen Offenbarung gibt, wenn ursprünglich offenbarte spezifische Ausführungsformen, Gruppen solcher Ausführungsformen oder Bereiche aus dem Schutzumfang eines allgemeineren Anspruchs, der eine ebenfalls offenbarte allgemeine Lehre widerspiegelt, ausgeklammert werden, so lässt sich diese Frage dennoch nicht schematisch entscheiden. Insbesondere ist kein Grundsatz erkennbar, der a priori dahin gehend anwendbar wäre, dass das Ausklammern offenbarter spezifischer Ausführungsformen, Gruppen solcher Ausführungsformen oder Bereiche aus einem breiteren Anspruch nie ein Verstoß gegen Artikel 123 (2) EPÜ sein kann. Es gelten auch keine sogenannten Gesetze der Logik, wonach bei einer Anmeldung, die eine allgemeine Lehre und spezifische Ausführungsformen, Gruppen solcher Ausführungsformen oder Bereiche offenbart, implizit auch potenzielle Ausführungsformen oder Zwischenverallgemeinerungen, die unter die allgemeine Lehre fallen (aber nicht als solche in der ursprünglich eingereichten Fassung der Anmeldung offenbart sind) zwangsläufig mit offenbart würden. Andererseits wäre auch eine schematische Begründung, die lediglich besagt, dass die Aufnahme des Disclaimers den im Anspruch verbleibenden Gegenstand verändert, weil dieser geänderte Anspruch weniger enthält als der ungeänderte Anspruch, nicht ausreichend für einen Einwand nach Artikel 123 (2) EPÜ.

4.5.4 Notwendigkeit einer technischen Beurteilung des jeweiligen Falls

Tatsächlich erforderlich ist dagegen eine Beurteilung aller technischen Umstände des jeweiligen Einzelfalls, bei der es Art und Umfang der Offenbarung in der ursprünglich eingereichten Fassung der Anmeldung, Art und Umfang des ausgeklammerten Gegenstands sowie dessen Verhältnis zu dem nach der Änderung im Anspruch verbleibenden Gegenstand zu berücksichtigen gilt.

Zu prüfen ist, ob der Fachmann unter Heranziehung des allgemeinen Fachwissens den verbleibenden beanspruchten Gegenstand als explizit oder implizit, aber unmittelbar und eindeutig in der ursprünglichen Fassung der Anmeldung offenbart ansehen würde.

Die Prüfung ist dieselbe, mit der auch die Zulässigkeit einer Anspruchsbeschränkung durch ein positiv definiertes Merkmal geprüft wird. Zu diesem Thema gibt es eine umfassende Rechtsprechung, insbesondere im Zusammenhang mit Fällen, in denen die Beschränkung dazu führen könnte, dass damit Verbindungen oder Unterklassen von Verbindungen oder andere sogenannte Zwischenverallgemeinerungen herausgelesen werden, die in der ursprünglich eingereichten Fassung der Anmeldung weder speziell erwähnt noch implizit offenbart sind (s. Rechtsprechung der Beschwerdekammern des Europäischen Patentamts, 6. Auflage, Juli 2010, III.A.1. und 2.). Die Grundsätze dieser Rechtsprechung können und müssen auf Anspruchsänderungen, bei denen offenbarte spezifische Ausführungsformen, Gruppen solcher Ausführungsformen oder Bereiche ausgeklammert werden, genauso angewandt werden wie auf Beschränkungen durch positiv definierte Merkmale.

Wenn etwa, wie in G 1/03 (Nr. 2.1.3 der Entscheidungsgründe) dargelegt, in der ursprünglich eingereichten Fassung der Anmeldung eine Erfindung allgemein offenbart und beansprucht wurde und darüber hinaus mehrere spezifische Ausführungsformen oder Gruppen solcher Ausführungsformen offenbart wurden, von denen eine später durch den Disclaimer aus dem Schutzbegehren ausgeklammert wird, so wird der verbleibende Gegenstand, d. h. die verbleibende allgemeine Lehre, durch den Disclaimer in der Regel nicht verändert. Anders verhält es sich dagegen, wenn z. B. der im Anspruch verbleibende Gegenstand durch den Disclaimer auf eine Untergruppe des ursprünglich beanspruchten Gegenstands beschränkt würde und diese Untergruppe nicht als in der ursprünglich eingereichten Fassung der Anmeldung offenbart angesehen werden könnte, auch nicht unter Berücksichtigung dessen, was der Fachmann unter Heranziehung des allgemeinen Fachwissens als implizit in der ursprünglich eingereichten Fassung der Anmeldung enthalten ansehen würde. In diesem Fall wäre die Änderung ein Verstoß gegen Artikel 123 (2) EPÜ. Analog zu der Entscheidung T 615/95 läge eine unzulässige Erweiterung vor, wenn die Aufnahme eines Disclaimers in einen Anspruch zur Abgrenzung einer bis dahin nicht speziell erwähnten oder zumindest implizit offenbarten einzelnen Verbindung oder Gruppe von Verbindungen führen würde oder zur Folge hätte, dass dem verbleibenden beanspruchten Gegenstand eine bestimmte, ursprünglich nicht offenbarte Bedeutung verliehen würde.

4.5.5 Relevanz der Tatsache, dass der ausgeklammerte Gegenstand als Teil der Erfindung offenbart ist

In der Entscheidung T 1102/00 und anderen, demselben Ansatz folgenden Entscheidungen wurde als Begründung dafür, dass das Ausklammern eines in der ursprünglich eingereichten Fassung der Anmeldung offenbarten Gegenstands nicht zulässig sei, ausgeführt, dass dieser Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung nicht als aus dem Schutzbereich auszuschließender Gegenstand, sondern vielmehr als Teil der Erfindung dargestellt worden sei. Diese Argumentation ist nicht stichhaltig.

Grundsätzlich ist es dem Anmelder überlassen, durch die Abfassung der Ansprüche den von ihm gewünschten Schutzumfang festzulegen. Nichts im EPÜ verpflichtet einen Anmelder dazu, in der jeweiligen Anmeldung den breitestmöglichen Schutz anzustreben, den ihre Offenbarung bietet. Auch besteht keine Verpflichtung, die Ansprüche so abzufassen, dass die bevorzugte Ausführungsform in ihren Schutzbereich fällt. Einen Anspruch so zu ändern, dass offenbarte Gegenstände ausgeschlossen werden, insbesondere, wenn eine bevorzugte Ausführungsform durch einen Disclaimer ausgeklammert wird, ist ein Risiko für den Anmelder, denn es ist klar, dass der ausgeklammerte Gegenstand nicht berücksichtigt werden kann, wenn es darum geht, ob der geänderte Anspruch die übrigen Erfordernisse des EPÜ erfüllt, z. B. Stützung durch die Beschreibung (Art. 84 EPÜ), ausreichende Offenbarung (Art. 83 EPÜ) und erfinderische Tätigkeit (Artikel 56 EPÜ). Im Zusammenhang mit der erfinderischen Tätigkeit können insbesondere die Fragen relevant werden, ob die Aufgabe im gesamten beanspruchten Bereich gelöst wurde, oder ob eine durch den verbleibenden beanspruchten Gegenstand erzielte vorteilhafte Wirkung aus der ursprünglich eingereichten Fassung der Anmeldung ableitbar ist.

Mit dieser Maßgabe, d. h. unter der Voraussetzung, dass der beanspruchte Gegenstand die Erfordernisse des EPÜ erfüllt, steht es dem Anmelder frei, d. h. hat der Anmelder das Recht, für eine Ausführungsform oder sogar für einen Teil der offenbarten Erfindung keinen Schutz zu beanspruchen. Es könnte z. B. sein, dass er zunächst an einem raschen Schutz für eine bevorzugte Ausführungsform interessiert ist und die allgemeine Lehre in einer Teilanmeldung weiterverfolgen will. Ob, und wenn ja, unter welchen Umständen in einem solchen Fall ein Disclaimer notwendig wäre, um das sogenannte Doppelschutzverbot zu umgehen, ist eine andere Frage. Es genügt die Feststellung, dass ein solches Verhalten nicht missbräuchlich und sogar legitim ist. In den Amicus-curiae-Schriftsätzen wurden für die Aufteilung einer Anmeldung in mehrere Anmeldungen für verschiedene Ausführungsformen auch andere mögliche Gründe erwähnt, die mit den Patentierbarkeitserfordernissen nichts zu tun haben, z. B. Lizenzierungszwecke.

Im Extremfall wäre, wenn es denn zuträfe, dass eine offenbarte Ausführungsform der Erfindung nicht ausgeklammert werden kann, weil sie in der Anmeldung als Teil der Erfindung enthalten war, überhaupt keine beschränkende Anspruchsänderung möglich, weil selbst eine Beschränkung durch positiv definierte Merkmale etwas aus dem Anspruch ausschließt, das vorher als Teil der Erfindung präsentiert wurde. Wird hingegen eine Ausführungsform in der ursprünglich eingereichten Fassung der Anmeldung nicht als Teil der Erfindung, sondern etwa als Stand der Technik oder als Vergleichsbeispiel dargestellt, so kann sie überhaupt nicht beansprucht werden.

Abschließend ist festzustellen, dass kein überzeugender Grund dafür vorgebracht wurde, die im Rahmen von Artikel 123 (2) EPÜ entwickelten Grundsätze für die Beurteilung von Anspruchsänderungen durch die Aufnahme positiver beschränkender Merkmale nicht ebenso auf Anspruchsbeschränkungen durch Disclaimer anzuwenden, die in der ursprünglichen Fassung der Anmeldung offenbarte Gegenstände ausklammern.

4.6 Einbettung dieses Ansatzes in andere offenbarungsrelevante Themen

Dieser Ansatz bewirkt keine Verzerrung, sondern vielmehr eine Wahrung der im EPÜ etablierten und auf dem Erstanmelderprinzip beruhenden strukturellen Beziehung zwischen den Bestimmungen, die den Stand der Technik definieren, und ihren Auswirkungen auf die Patentierbarkeit sowie den materiellrechtlichen Erfordernissen für die wirksame Inanspruchnahme einer Priorität (Begriff derselben Erfindung) oder die Einreichung von Teilanmeldungen und das Recht, die Anmeldung zu ändern. Es ist unabdingbar, dass in jeder Beziehung ein einheitliches Offenbarungskonzept angewandt wird und die Rechte eines Anmelders in all diesen Zusammenhängen einheitlich so festgelegt sind, dass sie sich auf die zum relevanten Zeitpunkt vorgenommene Offenbarung erstrecken, aber zugleich auf diese Offenbarung beschränkt sind. Dies wurde in der Stellungnahme G 2/98 betont, in der die Große Beschwerdekammer im Zusammenhang mit der Klärung des aus einer Anmeldung ableitbaren Prioritätsrechts eine enge Auslegung des Begriffs "derselben Erfindung" befürwortete und das Prioritätsrecht auf Gegenstände beschränkte, die der Fachmann unter Heranziehung des allgemeinen Fachwissens unmittelbar und eindeutig der früheren Anmeldung als Ganzes entnehmen kann (Nr. 9 der Entscheidungsgründe). In dieser Entscheidung betonte die Große Beschwerdekammer auch, dass ein Konzept, bei dem das Prioritätsrecht nicht von der Offenbarung des Prioritätsdokuments abhängig gemacht würde, den Patentschutz für Auswahlerfindungen untergraben könnte, und befand:

"Prioritätsansprüche sollten daher nicht anerkannt werden, wenn die fraglichen Auswahlerfindungen nach diesen Kriterien als "neu" anzusehen sind" (Nr. 8.4 der Entscheidungsgründe). Dasselbe muss für alle Änderungen einer Anmeldung nach Artikel 123 (2) EPÜ gelten. Sie dürfen nicht zu einem neuen Gegenstand führen.

Erneut bestätigt wurde die Wichtigkeit eines einheitlichen Offenbarungskonzepts in der Entscheidung G 1/03 (Nr. 2.2.2 der Entscheidungsgründe), in der die Große Beschwerdekammer darauf abhob, dass "das europäische Patentsystem in sich geschlossen sein muss und für die Zwecke der Artikel 54, 87 und 123 EPÜ dasselbe Offenbarungskonzept zugrundezulegen ist".

Mithin scheint der Ansatz, der hier im Hinblick auf die Erfordernisse angewandt wird, die erfüllt sein müssen, damit Änderungen durch die Aufnahme von Disclaimern für offenbarte Gegenstände nach Artikel 123 (2) EPÜ zulässig sind, nicht zu einem ungerechtfertigten Ergebnis bezüglich irgendeiner der oben behandelten Fragen zu führen.

Ebenso wenig beeinträchtigt dieser Ansatz das Recht des Anmelders nach Artikel 76 (1) EPÜ, die Anmeldung zu teilen und ihren Gegenstand in mehrere Anmeldungen aufzuspalten, denn nach Artikel 76 (1) Satz 2 EPÜ ist dieses Recht ohnehin auf den Gegenstand beschränkt, der als in der ursprünglich eingereichten Fassung der früheren Anmeldung (Stammanmeldung) offenbart angesehen werden kann (bei einer Kette von Teilanmeldungen: Ursprungsanmeldung, s. die Entscheidungen G 1/05 und G 1/06, ABl. EPA 2008, 271 und 307). Wenn der Gegenstand eines Anspruchs in einer Teilanmeldung, in dem eine in der Stammanmeldung offenbarte Ausführungsform durch einen Disclaimer ausgeklammert wird, nicht als zumindest implizit in der Stammanmeldung (oder - bei einer Kette von Teilanmeldungen - in der Ursprungsanmeldung) offenbart angesehen werden kann, weil der Disclaimer den in der Teilanmeldung verbleibenden beanspruchten Gegenstand auf etwas beschränkt, was nicht als in der ursprünglich eingereichten Fassung der Stammanmeldung bzw. der Ursprungsanmeldung offenbart angesehen werden kann, dann besteht kein Recht auf Einreichung einer Teilanmeldung für diesen Gegenstand.

Die gleichen Erwägungen gelten für das Prioritätsrecht, wenn die Priorität einer früheren Anmeldung in einer späteren Anmeldung beansprucht wird, in der ein in der prioritätsbegründenden Anmeldung offenbarter Gegenstand durch einen Disclaimer ausgeklammert wird.

Ebenso verhält es sich schließlich in Fällen nach Artikel 61 (1) b) EPÜ, wenn die berechtigte Person eine neue Anmeldung einreicht und die ursprüngliche Anmeldung auf den Gegenstand beschränkt werden muss, für den der ursprüngliche Anmelder seinen Anspruch behält. Wie alle Änderungen unterliegt auch eine solche Änderung den Erfordernissen des Artikels 123 (2) EPÜ. Dies bedeutet, dass die Beschränkung der ursprünglichen Anmeldung durch die Aufnahme eines Disclaimers nur soweit zulässig ist, wie der nach einer solchen Beschränkung im Anspruch verbleibende Gegenstand als in der ursprünglich eingereichten Fassung der <RES> Anmeldung offenbart angesehen werden kann.

4.7 Vorschlag des Präsidenten

Der Präsident hat in Fußnote 28 seines Vorbringens vorgeschlagen, dass in Fällen, in denen sich der im Anspruch verbleibende Gegenstand nicht unmittelbar und eindeutig aus der ursprünglich eingereichten Fassung der Anmeldung ableiten lässt, die Zulässigkeit des Disclaimers von den in der Entscheidung G 1/03 festgelegten Kriterien abhängig gemacht werden sollte.

Die Große Beschwerdekammer sieht keinerlei Legitimation für einen solchen Ansatz. Wie dem vorstehend entwickelten Standpunkt der Großen Beschwerdekammer zu entnehmen ist, lautet im Einklang mit den oben angeführten früheren Entscheidungen der Großen Beschwerdekammer der übergeordnete Grundsatz für die Zulässigkeit einer Änderung nach Artikel 123 (2) EPÜ, dass der Gegenstand eines geänderten Anspruchs dem Fachmann, der allgemeines Fachwissen heranzieht, in der ursprünglich eingereichten Fassung der Anmeldung zumindest implizit offenbart worden sein muss. Wie vorstehend ebenfalls ausgeführt, gilt dies gleichermaßen für den Gegenstand eines Anspruchs, dessen Umfang durch einen Disclaimer bestimmt wird. Ist dieses Erfordernis im jeweiligen Einzelfall nicht erfüllt, weil der Disclaimer den Anspruch auf einen Gegenstand (eine Untergruppe, eine Zwischenverallgemeinerung o. Ä.) beschränkt, der nicht als in der ursprünglich eingereichten Fassung der Anmeldung offenbart angesehen werden kann, so ist die Erteilung eines Patents auf einen solchen Anspruch nicht gerechtfertigt. Wie oben auch bereits erläutert, würde jede andere Sichtweise das auf dem Erstanmelderprinzip beruhende Rechtssystem des EPÜ und insbesondere die Patentierbarkeit von Auswahlerfindungen untergraben.

In der mündlichen Verhandlung vor der Großen Beschwerdekammer erläuterte der Vertreter des Präsidenten, warum vorgeschlagen worden sei, in Bezug auf die Zulässigkeit eines Disclaimers, der einen offenbarten Gegenstand ausklammert und dessen verbleibender Gegenstand die Erfordernisse des Artikels 123 (2) EPÜ nicht erfüllt, zusätzlich die in Antwort 2 der Entscheidung G 1/03 festgelegten Kriterien anzuwenden. Der Grund dafür sei, dass sonst bei einem Stand der Technik nach Artikel 54 (3) EPÜ ein Anmelder, der einen offenbarten Gegenstand ausklammert, schlechtergestellt sein könnte als ein Anmelder, der einen in seiner Anmeldung nicht offenbarten Gegenstand ausklammert. Laut G 1/03 müsse der Anmelder im letzteren Fall nämlich nicht nachweisen, dass der nach der Aufnahme des Disclaimers im Anspruch verbleibende Gegenstand als solcher auch in der ursprünglich eingereichten Fassung der Anmeldung offenbart worden sei.

Diese Diskrepanz ist nach Ansicht der Großen Beschwerdekammer nicht vorhanden. Die Große Beschwerdekammer legt G 1/03 nicht so aus, als sollten in Antwort 2 dieser Entscheidung erschöpfend die Bedingungen festgelegt werden, unter denen, wenn erfüllt, eine Änderung durch Aufnahme eines nicht offenbarten Disclaimers unter allen Umständen als nach Artikel 123 (2) EPÜ zulässig anzusehen wäre. Wie in Nummer 4.4.2 bereits ausgeführt, ging es bei den Fragen, die der Großen Beschwerdekammer in den Fällen G 1/03 und G 2/03 zur Beantwortung vorgelegt wurden, im Wesentlichen darum, ob, und wenn ja, unter welchen Umständen nicht offenbarte Disclaimer trotz fehlender Grundlage in der ursprünglich eingereichten Fassung der Anmeldung überhaupt grundsätzlich als zulässig angesehen werden können.

Diese Frage und nichts anderes hat die Große Beschwerdekammer in Antwort 2 beantwortet. Der von ihr in der ersten Zeile von Antwort 2 gewählte Wortlaut "ein Disclaimer kann zulässig sein" deutet darauf hin, dass die Große Beschwerdekammer mit den in Antwort 2 festgelegten Kriterien nicht erschöpfend definieren wollte, wann ein Disclaimer gegen Artikel 123 (2) EPÜ verstößt und wann nicht.

Somit wurde in der Entscheidung nicht entschieden, dass ein nicht offenbarter Disclaimer, wenn die Erfordernisse der Antwort 2 erfüllt sind, stets nach Artikel 123 (2) EPÜ zulässig wäre.

Entscheidungsformel

Aus diesen Gründen wird entschieden:

Die der Großen Beschwerdekammer vorgelegte Rechtsfrage wird wie folgt beantwortet:

1a. Die Änderung eines Anspruchs durch Aufnahme eines Disclaimers, der einen in der ursprünglich eingereichten Fassung der Anmeldung offenbarten Gegenstand ausklammert, verstößt gegen Artikel 123 (2) EPÜ, wenn der nach Aufnahme des Disclaimers im Patentanspruch verbleibende Gegenstand dem Fachmann, der allgemeines Fachwissen heranzieht, nicht in der ursprünglich eingereichten Fassung der Anmeldung unmittelbar und eindeutig offenbart wird, sei es implizit oder explizit.

1b. Ob dies der Fall ist, muss anhand einer technischen Beurteilung aller technischen Umstände des jeweiligen Einzelfalls bestimmt werden, bei der es Art und Umfang der Offenbarung in der ursprünglich eingereichten Fassung der Anmeldung, Art und Umfang des ausgeklammerten Gegenstands sowie dessen Verhältnis zu dem nach der Änderung im Anspruch verbleibenden Gegenstand zu berücksichtigen gilt.

Quick Navigation