T 1068/07 (Enzymatische DNA/SCRIPPS) of 25.6.2010

European Case Law Identifier: ECLI:EP:BA:2010:T106807.20100625
Datum der Entscheidung: 25 Juni 2010
Aktenzeichen: T 1068/07
Entscheidung der Großen Beschwerdekammer: G 0002/10
Anmeldenummer: 98920015.9
IPC-Klasse: C12Q 1/68
Verfahrenssprache: EN
Verteilung: A
Download und weitere Informationen:
Text der Entscheidung in DE (PDF, 32.513K)
Alle Dokumente zum Beschwerdeverfahren finden Sie im Register
Bibliografische Daten verfügbar in: DE | EN | FR
Fassungen: OJ
Bezeichnung der Anmeldung: -
Name des Anmelders: THE SCRIPPS RESEARCH INSTITUTE
Name des Einsprechenden: -
Kammer: 3.3.08
Leitsatz: -
Relevante Rechtsnormen:
European Patent Convention Art 123(2)
Schlagwörter: Hauptantrag und Hilfsantrag I - Erweiterung (bejaht)
Hilfsanträge II und III - Disclaimer
Vorlage an die Große Beschwerdekammer - bejaht
Orientierungssatz:

Der Großen Beschwerdekammer wird folgende Rechtsfrage vorgelegt:

Verstößt ein Disclaimer gegen Artikel 123 (2) EPÜ, wenn sein Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung als Ausführungsform der Erfindung offenbart war?

Angeführte Entscheidungen:
G 0001/03
G 0002/03
G 0001/07
T 1050/99
T 1139/00
T 0795/05
T 1107/06
Anführungen in anderen Entscheidungen:
G 0001/16
T 1068/07
T 1870/08

Sachverhalt und Anträge

I. Die Anmelderin (Beschwerdeführerin) hat Beschwerde gegen die am 2. Februar 2007 ergangene Entscheidung der Prüfungsabteilung eingelegt, mit der die als internationale Patentanmeldung WO 98/49346 veröffentlichte europäische Patentanmeldung Nr. 98 920 015.9 (im Folgenden "ursprünglich eingereichte Fassung der Anmeldung" genannt) zurückgewiesen worden war.

II. Der Entscheidung lagen ein Hauptantrag und ein erster Hilfsantrag zugrunde. Die Prüfungsabteilung war zu der Auffassung gelangt, dass beide Anträge nicht den Erfordernissen des Artikels 123 (2) EPÜ genügten, weil die in Anspruch 1 aufgenommenen Disclaimer keine Grundlage in der ursprünglich eingereichten Fassung der Anmeldung hätten. Ihres Erachtens erfüllten diese Disclaimer nicht die von der Großen Beschwerdekammer in G 1/03 (ABl. EPA 2004, 413) festgelegten Kriterien, weil die Vorveröffentlichung D1 (WO 96/17086), die den Gegenstand dieser Disclaimer offenbare und daher demselben Fachgebiet zuzuordnen sei wie die Anmeldung, nicht so unerheblich für die beanspruchte Erfindung sei und nicht so weitab von ihr liege, dass sie als zufällige Vorwegnahme betrachtet werden könne.

III. Es wurde Beschwerde eingelegt und eine Beschwerdebegründung eingereicht. Die Beschwerdeführerin beantragte die Erteilung eines Patents auf der Grundlage des der Prüfungsabteilung vorliegenden Hauptantrags bzw. Hilfsantrags I.

IV. Die Kammer lud die Beschwerdeführerin zu einer mündlichen Verhandlung und legte ihr in einer der Ladung beigefügten Mitteilung nach Artikel 15 (1) der Verfahrensordnung der Beschwerdekammern (VOBK) (ABl. EPA Beilage zum Amtsblatt 1/2010, 29) ihre vorläufige, unverbindliche Auffassung über die Sachfragen des Beschwerdeverfahrens dar.

V. Die Beschwerdeführerin reichte in ihrer Erwiderung auf die Mitteilung der Kammer die Hilfsanträge II und III ein.

VI. Der Hauptantrag der Beschwerdeführerin enthielt 46 Ansprüche. Anspruch 1 lautete wie folgt:

"1. Katalytisches DNA-Molekül mit ortsspezifischer Endonukleaseaktivität, die spezifisch ist für eine Nukleotidsequenz, die eine Spaltstelle in einer vorausgewählten Substratnukleinsäuresequenz definiert,

wobei das katalytische Molekül eine erste und eine zweite Substratbindungsregion aufweist, die eine Kernregion flankieren,

wobei das Molekül folgende Formel hat:

5' (X-R) - GGCTAGCT8ACAACGA - (X) 3'

in der

jedes X eine beliebige Nukleotidsequenz ist,

(X-R) für die erste Substratbindungsregion steht,

(X) für die zweite Substratbindungsregion steht,

R ein Nukleotid ist, das ein Basenpaar mit einem Pyrimidin in der vorausgewählten Substratnukleinsäuresequenz bilden kann,

T8 durch C oder A ersetzt werden kann,

wobei die erste Substratbindungsregion eine Sequenz hat, die durch komplementäre Basenpaarung an einen ersten Bereich der vorausgewählten Substratnukleinsäuresequenz binden kann,

wobei die zweite Substratbindungsregion eine Sequenz hat, die durch komplementäre Basenpaarung an einen zweiten Bereich der vorausgewählten Substratnukleinsäuresequenz binden kann,

wobei die erste Substratbindungsregion nicht die Sequenz 5' CTTTGGTTA 3' oder 5' CTAGTTA 3' hat,

wobei die zweite Substratbindungsregion nicht die Sequenz 5' TTTTTCC 3' hat

und wobei das katalytische DNA-Molekül keine ortsspezifische Endonukleaseaktivität für die folgende Sequenz aufweist:

5' - GGAAAAAGUAACUAGAGAUGGAAG - 3' (SEQ ID NO: 135)."

Die Ansprüche 2 bis 23 bezogen sich auf Ausführungsformen von Anspruch 1. Die Ansprüche 24 und 25 betrafen eine Zusammensetzung, umfassend zwei oder mehr Populationen von katalytischen DNA-Molekülen nach Anspruch 1, wobei jede Population von katalytischen DNA-Molekülen in der Lage ist, eine andere Nukleotidsequenz in einem Substrat zu spalten (Anspruch 24) oder ein anderes Substrat zu erkennen (Anspruch 25). Die Ansprüche 26 bis 29 betrafen ein Verfahren zur Spaltung eines Zielnukleinsäuremoleküls unter Verwendung eines katalytischen DNA-Moleküls nach Anspruch 1. Die Ansprüche 30 bis 46 bezogen sich auf ein Verfahren zur Konstruktion eines katalytischen DNA-Moleküls, das eine vorausgewählte Substratnukleinsäuresequenz in einem Zielnukleinsäuremolekül spaltet, umfassend die Schritte der Auswahl einer Substratnukleinsäuresequenz von 10 bis 26 Nukleotiden Länge in einem Zielnukleinsäuremolekül und der Synthetisierung eines Desoxyribonukleinsäuremoleküls mit einer ersten und einer zweiten Substratbindungsregion, die eine Kernregion flankieren, wobei das Molekül die Formel von Anspruch 1 hat.

VII. Der Hilfsantrag I der Beschwerdeführerin lautete wie der Hauptantrag, wobei die Ansprüche 2 und 3 des Hauptantrags gestrichen waren und der Gegenstand von Anspruch 2 ("R" steht für A oder G) in Anspruch 1 aufgenommen wurde.

VIII. Die Hilfsanträge II und III der Beschwerdeführerin lauteten wie der Hauptantrag, bis auf den Unterschied, dass der Schlussteil der Ansprüche 1 und 30, nämlich: "wobei die erste Substratbindungsregion nicht die Sequenz [...] (SEQ ID NO: 135) hat", durch einen Disclaimer ersetzt wurde, der im Hilfsantrag II wie folgt lautete:

"... mit der Maßgabe, dass das katalytische Molekül kein Molekül ist, in dem die erste und die zweite Bindungsregion durch komplementäre Basenpaarung an die folgende Substratnukleinsäure binden können:

5' - GGAAAAAGUAACUAGAGAUGGAAG - 3' (SEQ ID NO: 135)"

und der im Hilfsantrag III wie folgt lautete:

"... mit der Maßgabe, dass das katalytische Molekül kein Molekül ist, das eine ortsspezifische intermolekulare katalytische Spaltung des Substrats

5' - GGAAAAAGUAACUAGAGAUGGAAG - 3' (SEQ ID NO: 135)

bei 2 mM MgCl2, 150 mM KCl, pH 7,5, 37 °C und einer Rate von etwa kcat = 0,01 min-1 aufweist."

IX. Die mündliche Verhandlung fand am 25. Juni 2010 statt.

X. Das Vorbringen der Beschwerdeführerin lässt sich wie folgt zusammenfassen:

Artikel 123 (2) EPÜ

Hauptantrag und Hilfsantrag I

Die positiven Merkmale von Anspruch 1, nämlich ein katalytischer Kern und die Substratbindungssequenzen, die die 5'- und 3'-Regionen dieses katalytischen Kerns flankieren, würden eine generische Klasse von katalytischen DNA-Molekülen definieren, die in der ursprünglich eingereichten Fassung der Anmeldung mit "10-23" bezeichnet würden (Moleküle der Klasse A). Als Substratbindungssequenzen könnten alle Nukleotidsequenzen (X-R) und (X) fungieren, bis auf diejenigen, die in Anspruch 1 in Form von negativen Merkmalen aufgeführt seien. Anspruch 1 schließe außerdem katalytische DNA-Moleküle mit ortsspezifischer Endonukleaseaktivität für die Sequenz SEQ ID NO: 135 aus. Diese negativen Merkmale entsprächen den Merkmalen, mit denen die in Beispiel 5 in der ursprünglich eingereichten Fassung der Anmeldung beschriebenen Enzyme des Prototyps "10-23" definiert würden, die wiederum eine Unterklasse (Moleküle der Unterklasse B) der generischeren Moleküle der Klasse A darstellten. In der angefochtenen Entscheidung befand die Prüfungsabteilung, dass Anspruch 1 auf "Moleküle der Klasse A minus Moleküle der Unterklasse B" gerichtet sei, und weil die ursprünglich eingereichte Fassung der Anmeldung keinen Hinweis darauf enthalte, dass die "Moleküle der Unterklasse B" auszuschließen seien, gebe es für die negativen Merkmale in Anspruch 1 keine Grundlage nach Artikel 123 (2) EPÜ. Die Prüfungsabteilung räumte allerdings auch ein, dass Beispiel 6 der Anmeldung eine zweite Unterklasse von Molekülen innerhalb der generischeren Moleküle der Klasse A offenbare, nämlich die "weiteren Derivate" (Moleküle der Unterklasse C). Damit wurde anerkannt, dass sowohl die Klasse A als auch die Unterklassen B und C in der ursprünglich eingereichten Fassung der Anmeldung offenbart wurden.

Die Beschwerdeführerin vertrat die Auffassung, dass Anspruch 1 auf die Moleküle der Unterklasse C aus Beispiel 6 gerichtet sei. Die Stütze oder Grundlage für die negativen Merkmale von Anspruch 1 ergebe sich nicht aus einer expliziten Aussage in der ursprünglich eingereichten Fassung der Anmeldung, dass die Moleküle der Unterklasse B auszuschließen seien, sondern vielmehr aus einer expliziten Offenbarung der Unterklasse C, nämlich auf Seite 87, Zeilen 1 - 3 und 24 - 28 zusammen mit den Abbildungen 8 und 9, wonach weitere Derivate (Moleküle der Unterklasse C) durch Änderung der in den Abbildungen 8 und 9 gezeigten Substrate und Substratbindungssequenzen der Moleküle des Prototyps "10-23" gewonnen werden könnten. Das Substrat und die Substratbindungssequenzen der Moleküle der Unterklasse C würden also in der ursprünglich eingereichten Fassung der Anmeldung anhand von Eigenschaften beschrieben, die sie nicht hätten, nämlich dass sie weder das Substrat noch die Substratbindungssequenz der Moleküle des Prototyps "10-23" aufwiesen. Die beanspruchten Moleküle seien keine Moleküle des Prototyps "10-23" und hätten auch nicht dieselbe Substratsequenz wie die Moleküle des Prototyps "10-23". Sie hätten ortsspezifische Endonukleaseaktivität gegen eine neue, große Bandbreite von Substratsequenzen, im Gegensatz zu den Molekülen des Prototyps "10-23", die nur gegen eine einzige Substratsequenz, SEQ ID NO: 135, Aktivität hätten. Die in den Abbildungen 8 und 9 gezeigten Substrate und Bindungssequenzen der Moleküle des Prototyps "10-23" in Kombination mit den Passagen auf Seite 87, Zeilen 1 - 3 und 24 - 28 in der ursprünglich eingereichten Fassung der Anmeldung seien eine explizite Stütze für die negativen Merkmale von Anspruch 1.

Wichtig sei, dass alle in Beispiel 6 offenbarten, von den Enzymen des Prototyps "10-23" abgeleiteten katalytischen DNA-Moleküle andere Substratbindungssequenzen hätten als die Moleküle des Prototyps "10-23" und auf anderen Substratsequenzen aktiv seien als die Enzyme des Prototyps "10-23" - wie z. B. in Tabelle 4 des Beispiels 6 gezeigt. Die Substratsequenz der Enzyme des Prototyps "10-23" werde in Beispiel 5 offenbart und in den Abbildungen 8 und 9 gezeigt. Dies sei die einzige Substratsequenz, die in Beispiel 5 verwendet werde, um die intermolekulare Spaltungsreaktion der Moleküle des Prototyps "10-23" zu veranschaulichen. In diesem Beispiel werde auf keine andere Substratsequenz für die Enzyme des Prototyps "10-23" verwiesen. Alle in Beispiel 5 enthaltenen Verweise auf andere Zielsequenzen und auf Modifikationen und Änderungen der ursprünglichen Substratnukleotidsequenzen fänden sich einzig und allein im Zusammenhang mit der Selbstspaltungsreaktion und dem in der ursprünglich eingereichten Fassung der Anmeldung offenbarten Verfahren zur Generierung und Isolierung (durch Amplifikationsrunden) geeigneter einzelner Klone katalytischer DNA-Moleküle, z. B. der zur Veranschaulichung angeführten Moleküle des Prototyps "10-23" (in Tabelle 3 gezeigt).

Alles in allem definiere die Passage auf Seite 87, Zeilen 24 - 28 der ursprünglich eingereichten Fassung der Anmeldung eine Untergruppe von Varianten der Moleküle des Prototyps "10-23" (Moleküle der Unterklasse C). Im Lichte des gesamten Beispiels 6 betrachtet, enthalte diese Passage eine klare und eindeutige Lehre, die Substratbindungssequenzen des Enzyms gegenüber denen des Moleküls des Prototyps "10-23" zu ändern, um andere Substrate zu spalten als das Substrat des Prototyps "10-23". Diese Passage lehre ein Verfahren zur Herstellung von katalytischen DNA-Molekülen, die auf anderen Substratsequenzen aktiv seien als derjenigen des Prototyps "10-23", und zwar durch komplementäre Änderung der Substratbindungssequenzen des Enzyms des Prototyps "10-23". Das zwangsläufige Erzeugnis eines solchen Verfahrens sei eine generische Untergruppe oder Unterklasse von katalytischen DNA-Molekülen, die sich von den Enzymen des Prototyps "10-23" durch die Substratbindungssequenzen und durch das Substrat, das sie spalten könnten, unterschieden, d. h. der Gegenstand von Anspruch 1.

Nach der ständigen Rechtsprechung werde durch die Offenbarung eines Verfahrens, das zwangsläufig zu einem per se nicht explizit beschriebenen Erzeugnis führe, auch das so hergestellte Erzeugnis offenbart. Mit Artikel 123 (2) EPÜ sei die Änderung eines Anspruchs - durch Aufnahme eines implizit offenbarten Merkmals - vereinbar, wenn die implizite Offenbarung sich klar und eindeutig aus der expliziten Offenbarung ergebe. Die im Hauptantrag und im Hilfsantrag I beanspruchten katalytischen DNA-Moleküle seien als implizite Konsequenz der expliziten Offenbarung in der Passage auf Seite 87, Zeilen 24 - 28 der ursprünglich eingereichten Fassung der Anmeldung offenbart. Daher seien die Erfordernisse des Artikels 123 (2) EPÜ erfüllt.

Hilfsanträge II und III

In beiden Anträgen definiere der Disclaimer die katalytischen Moleküle mit der Struktur der Moleküle des Prototyps "10-23", die in Beispiel 5 und den Abbildungen 8 und 9 der ursprünglich eingereichten Fassung der Anmeldung als eine Ausführungsform der Erfindung offenbart würden. Ein solcher Disclaimer müsse zugelassen werden, wenn den Entscheidungen T 1107/06 vom 3. Dezember 2008 und T 1139/00 vom 10. Februar 2005 gefolgt werde, laut denen die in G 1/03 (s. o.) festgelegten Kriterien nicht gälten, wenn der auszuschließende Gegenstand ursprünglich als eine Ausführungsform der Erfindung offenbart worden sei. Beabsichtige die Kammer jedoch, dem u. a. in der Entscheidung T 1050/99 vom 25. Januar 2005 vertretenen Standpunkt zu folgen, wonach Disclaimer auf der Grundlage von Ausführungsformen, die in der Anmeldung in der ursprünglich eingereichten Fassung als Teil der Erfindung offenbart seien, als nicht offenbarte Disclaimer nach G 1/03 (s. o.) gälten, so werde die Kammer auf die Bemerkungen der Großen Beschwerdekammer in ihrer Entscheidung G 1/07 vom 15. Februar 2010 aufmerksam gemacht (zur Veröffentlichung im ABl. EPA vorgesehen), worin die abweichende Rechtsprechung zu Disclaimern im Zusammenhang mit offenbarten Ausführungsformen thematisiert werde (vgl. Nr. 4.2.3 der Entscheidungsgründe). Angesichts dessen werde, bevor eine für die Beschwerdeführerin nachteilige Entscheidung ergehe, eine Vorlage an die Große Beschwerdekammer beantragt. Dafür schlage die Beschwerdeführerin folgende Frage vor:

"1. Ist die Änderung eines Anspruchs durch die Aufnahme eines Disclaimers schon deshalb nach Artikel 123 (2) EPÜ unzulässig, weil der durch ihn aus dem Schutzumfang des Anspruchs ausgeschlossene Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung durch eine positive Formulierung offenbart wird?"

XI. Die Beschwerdeführerin (Anmelderin) beantragte die Aufhebung der angefochtenen Entscheidung und die Erteilung eines Patents auf der Grundlage des am 30. Mai 2005 eingereichten Hauptantrags oder des am 19. Dezember 2006 eingereichten Hilfsantrags I oder der am 25. Mai 2010 eingereichten Hilfsanträge II oder III bzw. die Vorlage der in der mündlichen Verhandlung unterbreiteten Frage an die Große Beschwerdekammer.

Entscheidungsgründe

Artikel 123 (2) EPÜ

Hauptantrag und Hilfsantrag I

1. In Anspruch 1 dieser beiden Anträge wird das katalytische DNA-Molekül durch mehrere positive Merkmale charakterisiert und dann durch drei negative Merkmale eingeschränkt ("wobei [...] nicht [...]") (s. vorstehend Nrn. VI und VII). Für Letzteres fand die Prüfungsabteilung weder eine explizite noch eine implizite Stütze in der ursprünglich eingereichten Fassung der Anmeldung. Außerdem war sie der Ansicht, dass die betreffenden Merkmale, wenn sie als Disclaimer angesehen würden, nicht zugelassen werden könnten, weil sie nicht die in G 1/03 (s. o.) festgelegten Kriterien erfüllten. Daher wurde die Anmeldung nach Artikel 123 (2) EPÜ zurückgewiesen (s. vorstehend. Nr. II).

2. Die Beschwerdeführerin bringt vor, dass die Entscheidung falsch war. Ihrer Ansicht nach ist der Gegenstand von Anspruch 1 als solcher in der ursprünglich eingereichten Fassung der Anmeldung offenbart. Dies schließt die negativen Merkmale ein, die zwar nicht explizit offenbart sind, aber trotzdem implizit und eindeutig aus der ursprünglichen Offenbarung herleitbar sind, insbesondere aus Seite 87, Zeilen 1 - 3 und 24 - 28, Beispiel 6 und den Abbildungen 8 und 9 (s. vorstehend Nr. X).

3. Beispiel 6 in der ursprünglich eingereichten Fassung der Anmeldung ist überschrieben mit "Herstellung eines Universalssubstratenzyms". Es beginnt mit einem Verweis auf die "vorangehende" Offenbarung, der zufolge ein Enzym mit der Fähigkeit hergestellt werden kann, Zielnukleinsäuren mit vorausgewählten Sequenzen katalytisch zu spalten, und es endet mit dem Hinweis "außerdem zeigt sich, dass das Substrat modifiziert und ein Enzym hergestellt werden kann, das dieses Substrat spalten kann" (s. Seite 86, Zeilen 5 - 13).

4. Auf Seite 87 heißt es im ersten Absatz: "Im folgenden Abschnitt wird die Herstellung von verbesserten Enzymen auf der Grundlage der oben beschriebenen Motive "10-23" und "8-17" beschrieben. Diese verbesserten Enzyme sind generische Enzyme, die jede vorausgewählte Zielsequenz spalten können, und diese Zielspezifität hängt allein von der Sequenz der Substratbindungsregionen der Enzyme ab, wie im Folgenden weiter beschrieben wird". Die Angabe "jede vorausgewählte Zielsequenz" zeigt den breiten Zweck des Beispiels; mit Sicherheit darin enthalten (d. h. nicht ausgeschlossen) ist die Zielsequenz bzw. das Substratmolekül, das in Beispiel 5 ausgewählt wurde, um das Prototypmotiv "10-23" zu generieren und zu isolieren (durch intramolekulare Selbstspaltungsevolution) sowie seine enzymatische Aktivität zu messen (durch intermolekulare Spaltungsreaktion), wie in den Abbildungen 8 und 9 der ursprünglich eingereichten Fassung der Anmeldung gezeigt.

5. Auf Seite 87 findet sich nach Bezugnahmen auf Beispiel 5, auf den Spaltungsmechanismus des Prototypmotivs "10-23" und auf die resultierenden Spaltungsprodukte in den Zeilen 24 - 28 folgende Aussage: "Für die Enzyme mit den Motiven 8-17 und 10-23 kann die Sequenz des Substrats ohne Verlust der katalytischen Aktivität geändert werden, solange die Substratbindungsarme des Enzyms komplementär geändert werden" (wobei das Enzym mit dem Motiv "8-17" ein weiteres spezifisches katalytisches DNA-Molekül ist, das in Beispiel 5 isoliert wird).

6. Die Beschwerdeführerin führt diese Passage der Beschreibung als eine Art positive Stütze für die negativen Merkmale an, mit denen die Definition des beanspruchten katalytischen DNA-Moleküls eingeschränkt wird. Ihrer Ansicht nach werden nämlich, wenn man das Substrat des Enzyms mit dem Motiv "10-23" ändert, die in den Abbildungen 8 und 9 gezeigten spezifischen Substratbindungsarme und die spezifische Substratsequenz des Prototypmoleküls aus dem Schutzbereich ausgeschlossen, und zwar durch die drei negativen Merkmale in Anspruch 1. Gestützt wird diese Auffassung angeblich noch durch die Tatsache, dass alle in Beispiel 6 offenbarten, vom Prototyp "10-23" abgeleiteten Enzyme (vgl. Tabelle 4), die ein anderes Substrat haben als der Prototyp "10-23", auch andere Substratbindungsarme haben als dieser Prototyp. Laut der Beschwerdeführerin ist unter diesen Umständen das Erzeugnis des Anspruchs 1 die implizite Konsequenz der expliziten Offenbarung, weshalb kein Verstoß gegen Artikel 123 (2) EPÜ vorliege.

7. Die Kammer kann sich der Argumentation der Beschwerdeführerin nicht anschließen. Die Passage, auf die sich die Beschwerdeführerin bezieht, enthält weder eine explizite Offenbarung eines spezifischen Substrats noch einen Hinweis, der dieses Substrat mit dem in den Abbildungen 8 und 9 konkret veranschaulichten in Verbindung bringt. Ebensowenig werden Art und Beschaffenheit der Änderungen begrenzt oder eingeschränkt, die am Substrat oder, komplementär, an den Substratbindungsarmen des Enzyms mit dem Prototypmotiv "10-23" vorgenommen werden können. Die fragliche Passage ist daher so zu verstehen, dass sie sich auf eine generische, aus dem Enzym mit dem Prototypmotiv "10-23" abgeleitete Gruppe von katalytischen DNA-Molekülen bezieht. Außerdem ist nach Ansicht der Kammer diese Passage im Kontext und im Lichte der Informationen und der Lehre des Beispiels 5 zu verstehen, auf das sich Beispiel 6 bezieht.

8. In Beispiel 5 wird die anfängliche Selbstspaltungsreaktion, die zur Generierung und Isolierung des Enzyms mit dem Prototypmotiv "10-23" verwendet wird, später in eine intermolekulare Spaltungsreaktion umgewandelt (durch Zerlegung des Enzyms und der Substratdomänen in separate Moleküle), und obwohl für diese Reaktion als spezifisches Substrat für das Enzym mit dem Motiv "10-23" exemplarisch nur dasjenige aus den Abbildungen 8 und 9 angeführt ist (vgl. Seite 84, Zeile 2 bis Seite 86, Zeile 2), wird in diesem Beispiel explizit doch auch die Verwendung anderer, alternativer Substrate in Betracht gezogen. In der Selbstspaltungsreaktion ist die Zielsequenz (12 hoch konservierte Nukleotide innerhalb der Region U5 LTR von HIV-1 RNA) eigentlich in eine längere Substratsequenz eingebettet, die, wie in Beispiel 5 explizit angegeben, optional modifiziert werden kann. De facto ist die exemplarisch angeführte Substratsequenz aus der ursprünglich gegebenen Sequenz (SEQ ID NO: 50) durch Hinzufügen eines zusätzlichen dA-Rests abgeleitet (vgl. Seite 75, Zeile 24 bis Seite 76, Zeile 10). Ähnliche Modifikationen "z. B. nach Länge, Nukleotidsequenz, Nukleinsäuretyp" werden in Beispiel 5 auch allgemein behandelt, wenn auch nur im Kontext der Selbstspaltungsreaktionen zur Generierung enzymatischer DNA-Moleküle mit alternativen Spezifitäten (vgl. Seite 83, Zeilen 2 - 24).

9. Es lässt sich argumentieren, dass in Ermangelung expliziter Angaben in Beispiel 5 der Fachmann einige dieser Substratsequenzen in einer intermolekularen Spaltungsreaktion auch als mögliche geeignete Substrate für das Enzym mit dem Prototypmotiv "10-23" in Erwägung ziehen, verstehen oder ansehen könnte (Abbildung 8 stützt dies, indem sie ein gewisses Maß an Flexibilität in der Interaktion zwischen dem Substrat und den Substratbindungsarmen durch die Standard-Watson-Crick-Paarung zeigt). Es kann jedenfalls kein Zweifel daran bestehen, dass alle in Beispiel 5 beschriebenen Änderungen und Modifikationen der Substratsequenz auch in der oben genannten Passage, die die Beschwerdeführerin als Grundlage für den beanspruchten Gegenstand anführt, mitgemeint oder enthalten sein könnten.

10. Nach Ansicht der Kammer umfasst die Offenbarung der fraglichen Passage daher Änderungen und Modifikationen im Substrat des Enzyms mit dem Prototypmotiv "10-23", die unter Umständen keinerlei komplementäre Änderung in den zwei Substratbindungsarmen oder zumindest in einem davon erfordern (z. B. bei Verkürzung des 3'-Endes oder Verlängerung des 5'- und/oder des 3'-Endes dieses Substrats, Änderung des Nukleinsäuretyps usw.). Bei umfangreicheren Änderungen oder Modifikationen im Substrat wären sicherlich substanzielle komplementäre Änderungen in beiden oder zumindest in einem der Substratbindungsarme notwendig. All diese Änderungen und somit auch alle daraus resultierenden Gruppen bzw. Untergruppen katalytischer DNA-Moleküle sind in der generischen Offenbarung impliziert, die die Beschwerdeführerin anzieht.

11. Infolgedessen stellt der durch negative Merkmale bewirkte Ausschluss der spezifischen (ersten und zweiten) Substratbindungsarme und der spezifischen Substratsequenz des Prototypmotivs "10-23" (vgl. Abbildungen 8 und 9) aus dem Schutzbereich von Anspruch 1 eine Auswahl aus der größeren Bandbreite der in Beispiel 6, insbesondere auf Seite 87, Zeilen 24 - 28, vorgeschlagenen Änderungen dar. Für diese Auswahl findet sich in der ursprünglich eingereichten Fassung der Anmeldung keine unmittelbare und eindeutige Stütze. Aus diesem Grund verstößt Anspruch 1 in beiden Anträgen gegen Artikel 123 (2) EPÜ, sodass weder dem Hauptantrag noch dem Hilfsantrag I stattgegeben werden kann.

Hilfsanträge II und III

12. In diesen beiden Anträgen wurden die negativen Merkmale, die Anspruch 1 der vorhergehenden Anträge charakterisierten, durch einen Disclaimer ersetzt (s. vorstehend Nr. VIII).

13. Die Beschwerdeführerin macht geltend, dass der Disclaimer in beiden Fällen mit den Erfordernissen von Artikel 123 (2) EPÜ in Einklang stehe, wenn man dem z. B. in T 1107/06 (s. o.) vertretenen Standpunkt folgt, wonach ein Disclaimer nicht gegen Artikel 123 (2) EPÜ verstößt, wenn sein Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung als eine Ausführungsform der Erfindung offenbart wird.

14. Tatsächlich ist bei diesen beiden Anträgen der Gegenstand des Disclaimers als Ausführungsform der Erfindung offenbart, weil i) ein katalytisches Molekül, "in dem die erste und die zweite Bindungsregion durch komplementäre Basenpaarung an die Substratnukleinsäure: 5' - GGAAAAAGUAACUAGAGAUGGAAG - 3' (SEQ ID NO: 135) binden können" (vgl. Hilfsantrag II), u. a. auf Seite 85, Zeilen 2 - 26 und Abbildung 9 der ursprünglich eingereichten Fassung der Anmeldung beschrieben wird;

und ii) ein katalytisches Molekül, "das eine ortsspezifische intermolekulare katalytische Spaltung des Substrats 5' - GGAAAAAGUAACUAGAGAUGGAAG - 3' (SEQ ID NO:135) bei 2 mM MgCl2, 150 mM KCl, pH 7,5, 37 °C und einer Rate von etwa kcat = 0,01 min-1 bewirkt" (vgl. Hilfsantrag III), u. a. auf Seite 87, Zeilen 13 - 18 und Abbildung 9 der ursprünglich eingereichten Fassung der Anmeldung beschrieben wird.

15. Wie Nummer 4.2.3 von G 1/07 (s. o.) zu entnehmen ist, wurden im Anschluss an die Entscheidungen G 1/03 (s. o.) und G 2/03 (ABl. EPA 2004, 448), die sich mit dem Thema der sogenannten "nicht offenbarten" Disclaimer befassten, in der Rechtsprechung der Beschwerdekammern unterschiedliche Auffassungen dazu vertreten, ob sich die in diesen Entscheidungen getroffenen Feststellungen auch auf das Ausklammern von Ausführungsformen beziehen, die in der ursprünglich eingereichten Fassung der Anmeldung als Teil der Erfindung offenbart waren. So sind einerseits Disclaimer zu solchen Ausführungsformen in einer Reihe von Entscheidungen unter Berufung auf das Konzept der "nicht offenbarten Disclaimer" zurückgewiesen worden (vgl. z. B. T 1050/99 (s. o.) und T 795/05 vom 13. Dezember 2007). Dieser Ansatz findet sich auch in den Richtlinien für die Prüfung (vgl. Teil C, Kapitel III-19, 4.20, April 2010). Andererseits ist in den Entscheidungen T 1107/06 (s. o.) und T 1139/00 (s. o.) der Standpunkt vertreten worden, dass die in G 1/03 und G 2/03 (s. o.) festgelegten Kriterien nicht gelten und somit ein Disclaimer auf der Grundlage solcher "offenbarter" Ausführungsformen zugelassen werden kann.

16. In der vorliegenden Sache macht es einen entscheidenden Unterschied, ob der erste Ansatz verfolgt wird oder der zweite, denn im ersten Fall müssten die Hilfsanträge II und III nach Artikel 123 (2) EPÜ zurückgewiesen werden, was die Zurückweisung der Beschwerde zur Folge hätte, während im zweiten Fall diese Anträge nicht gegen Artikel 123 (2) EPÜ verstoßen würden und die angefochtene Entscheidung aufgehoben werden könnte.

17. Vor diesem Hintergrund und in Anbetracht der Artikel 112 (1) a) EPÜ und 22 VOBK sowie des ausdrücklichen Antrags der Beschwerdeführerin hält die Kammer es für angezeigt, die Große Beschwerdekammer zu befassen.

18. Eine entsprechende Frage wurde von der Beschwerdeführerin unterbreitet (s. vorstehend Nr. X, letzter Absatz). Die Kammer zieht es jedoch vor, aus Gründen der Einfachheit der Formulierung von Amts wegen die in der nachstehenden Entscheidungsformel genannte Rechtsfrage vorzulegen.

19. Da die anhängige Frage aus rechtlicher Sicht bereits ausführlich in der Rechtsprechung der Beschwerdekammern behandelt wurde, sieht die Kammer keine Notwendigkeit, eine weitergehende Analyse für die Große Beschwerdekammer durchzuführen.

Entscheidungsformel

Aus diesen Gründen wird entschieden:

Der Großen Beschwerdekammer wird von Amts wegen folgende Frage vorgelegt:

"Verstößt ein Disclaimer gegen Artikel 123 (2) EPÜ, wenn sein Gegenstand in der ursprünglich eingereichten Fassung der Anmeldung als Ausführungsform der Erfindung offenbart war?"

Quick Navigation